View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19368_low_72 (Length: 221)
Name: NF19368_low_72
Description: NF19368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19368_low_72 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 62 - 200
Target Start/End: Complemental strand, 47907533 - 47907395
Alignment:
| Q |
62 |
tgaataaaacatgtgtacttattaatcaataaatacatatatgtttttggtgccataagggttaattttctcttcnnnnnnncttaaccaaggaaaacta |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47907533 |
tgaataaaacatgtgtacttattaatcaataaatacatatatgtttttggtgccataagggttaattttctcttctttttttcttaaccaaggaaaacta |
47907434 |
T |
|
| Q |
162 |
attcgtttcattgcaaataatatttcatggttagtatac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47907433 |
attcgtttcattgcaaataatatttcatggttagtatac |
47907395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 47907610 - 47907565
Alignment:
| Q |
1 |
tcaacccttccattctagtcaatccccttcttgttgatcataaact |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47907610 |
tcaacccttccattctagtcaatccccttcttgttgatcataaact |
47907565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University