View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1936_high_16 (Length: 304)
Name: NF1936_high_16
Description: NF1936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1936_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 1 - 299
Target Start/End: Original strand, 42015985 - 42016283
Alignment:
| Q |
1 |
tttctcttgagttcttcatttcatgacactgatattgcaaaaattggacttgttttgtaaccattttttacttatgggaattgttgcaggttccctttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42015985 |
tttctcttgagttcttcatttcatgacactgatattgcaaaaattggacttgttttgtaaccattttttacttatgggaattgttgcaggttccctttgg |
42016084 |
T |
|
| Q |
101 |
gaagatagtgaggtgtcctacttgtcggatagctgttgcagttgcacagccacagcaaggtattcaggtatttgttatccctcaccttgcctatacccaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42016085 |
gaagatagtgaggtgtcctacttgtcggatagctgttgcagttgcacagccacagcaaggtattcaggtatttgttatccctcaccttgcctatacccaa |
42016184 |
T |
|
| Q |
201 |
tattaattcatttttagtttggttctcctacgcaataattcaatgagttcgatttcggattagatctttcaattattatgtaatttattactatctctg |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42016185 |
tattaattcatttttagtttggttctcctacgcaataattcaatgagttcgatttcggattagatctttcaattattatgtaatttattactatctctg |
42016283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University