View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1936_high_19 (Length: 281)
Name: NF1936_high_19
Description: NF1936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1936_high_19 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 281
Target Start/End: Complemental strand, 5584783 - 5584522
Alignment:
| Q |
20 |
tagtattggttccaatacaagaatcggtgatgcattcttgtttcttgagttggtgannnnnnnnaaactgcgttattgatgtgaaatatttatcggcttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||||| |||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5584783 |
tagtattggttccaatacaagaatcggtgatgcattcttgttccctgagttagtgattttttttaaactgcgttattgatgtaaaatatttatcggcttt |
5584684 |
T |
|
| Q |
120 |
gtcgatgacccgtctttattcgagaactcgtcaaattatttttaatagggcatctccttcaattaaattcttttatccacaaaactcaaacttaagacat |
219 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||| ||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
5584683 |
gtcgatgacccgtctttattacagaactcgtcaaactatttttaatagggtatctccttcaactatattcttttatccacaaaactcaaacttaagacat |
5584584 |
T |
|
| Q |
220 |
tgcttaaataatctgagtcgaaatctactcagatcggttgtaatattggtgaattaatgatg |
281 |
Q |
| |
|
| ||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
5584583 |
tacttaaataatctgagtcgaaatctacttagattggttgtaatattggtgaattaatgatg |
5584522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University