View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1936_high_22 (Length: 266)
Name: NF1936_high_22
Description: NF1936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1936_high_22 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 16 - 266
Target Start/End: Complemental strand, 47534980 - 47534730
Alignment:
| Q |
16 |
atagagaatgcaacttattgccnnnnnnnnntgttggaatattcttgagaagaatcatgttggtgatgaaaaactcaagaaggttcaattacaaacactg |
115 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47534980 |
atagagaatgcaacttattgccaaaaaaaaatgttggaatattcttgagaagaatcatgttggtgatgaaaaactcaagaaggttcaattacaaacactg |
47534881 |
T |
|
| Q |
116 |
aagaggcagtttgagttgttgctggtggaaccaagtgagaacattgcagagaatttcaactaagttacttgcgatgatgaagtatttgatcaaacaatta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47534880 |
aagaggcagtttgagttgttgctggtggaaccaagtgagaacattgcagagaatttcaacaaagttacttgcgatgatgaagtatttgatcaaacaatta |
47534781 |
T |
|
| Q |
216 |
tgaacaaggttatgcacattatatcaacttgactgtatttaagttgctata |
266 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47534780 |
tgaacagggttatgcacattatatcaacttgactgtatttaagttgctata |
47534730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University