View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1936_high_31 (Length: 234)
Name: NF1936_high_31
Description: NF1936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1936_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 4724984 - 4724771
Alignment:
| Q |
1 |
gaaaacgaaagcggtagtagcaaaagtttcttccgcaatttgaaggaaattttggatgagttcatgagacaacaattgcaaattgaagcacaatggatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4724984 |
gaaaacgaaagcggtagtagcaaaagtttcttccgcaatttgaaggaaattttggatgagttcatgagacaacaattgcaaattgaagcacaatggatgg |
4724885 |
T |
|
| Q |
101 |
aagcatttgaagctagagagaatgaaaggaggttgagggagatggagtggagacaacaaatggaaatgcttgagaatgagaggatattgatggaacaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4724884 |
aagcatttgaagctagagagaatgaaaggaggttgagggagatggagtggagacaacaaatggaaatgcttgagaatgagaggatattgatggaacaaag |
4724785 |
T |
|
| Q |
201 |
atggagagaaaggg |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4724784 |
atggagagaaaggg |
4724771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 36 - 214
Target Start/End: Original strand, 25259387 - 25259565
Alignment:
| Q |
36 |
caatttgaaggaaattttggatgagttcatgagacaacaattgcaaattgaagcacaatggatggaagcatttgaagctagagagaatgaaaggaggttg |
135 |
Q |
| |
|
|||||||||||| ||| | || ||||| ||||| |||||| ||||||| ||||| ||||||||||||||||||||||| ||||||||||| ||||| ||| |
|
|
| T |
25259387 |
caatttgaaggagattcttgaggagtttatgaggcaacaaatgcaaatggaagctcaatggatggaagcatttgaagcaagagagaatgagaggagattg |
25259486 |
T |
|
| Q |
136 |
agggagatggagtggagacaacaaatggaaatgcttgagaatgagaggatattgatggaacaaagatggagagaaaggg |
214 |
Q |
| |
|
| ||||||||||||||||||| ||||||| | ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25259487 |
aaggagatggagtggagacaaagaatggaagcattggagaatgagaggataatgatggaacaaagatggagagaaaggg |
25259565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University