View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1936_low_25 (Length: 269)
Name: NF1936_low_25
Description: NF1936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1936_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 7954496 - 7954247
Alignment:
| Q |
1 |
atactcatatcgccaaacaattcagctcacaagctcaatatattgcttcaattagtaccacttagatgaaatgcatatttagatcatatggaagagcata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7954496 |
atactcatatcgccaaacaattcagctcacaagctcaatatattgcttcaattagtaccacttagatgaaatgcatatttagatcatatggaagagcata |
7954397 |
T |
|
| Q |
101 |
catttaaactgtttggtggttggaggccaacagtttgagccggtgaaaaattgtatcgtcaattcattcacgaaagtcagccaacgctttataaactaaa |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
7954396 |
catttaaactgtttggtggttagaggccaacagtttgagccggtgaaaaattgaatcgtcgattcattcatgaaagtcagccagcgctttataaactaaa |
7954297 |
T |
|
| Q |
201 |
tgaggtaattttgcaacagctgaggaaaagtacttttgcccttagttttg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7954296 |
tgaggtaattttgcaacagctgaggaaaagtacttttgcccttagttttg |
7954247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 26135414 - 26135463
Alignment:
| Q |
12 |
gccaaacaattcagctcacaagctcaatatattgcttcaattagtaccac |
61 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
26135414 |
gccatacaattcagctcacaagctcagtatattgctccaattagtaccac |
26135463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 74 - 153
Target Start/End: Original strand, 26135557 - 26135631
Alignment:
| Q |
74 |
catatttagatcatatggaagagcatacatttaaactgtttggtggttggaggccaacagtttgagccggtgaaaaattg |
153 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| || |||| |||| |||||||| |||| |||||| |
|
|
| T |
26135557 |
catatttagatcatatggaagagca-----ttaaactgtttggtgtttagagggtaacactttgagcctgtgagaaattg |
26135631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University