View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1936_low_39 (Length: 216)
Name: NF1936_low_39
Description: NF1936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1936_low_39 |
 |  |
|
| [»] chr4 (149 HSPs) |
 |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |
|
| [»] chr7 (119 HSPs) |
 |  |
|
| [»] chr5 (122 HSPs) |
 |  |
|
| [»] chr3 (150 HSPs) |
 |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |
|
| [»] chr8 (159 HSPs) |
 |  |
|
| [»] chr6 (101 HSPs) |
 |  |
|
| [»] chr1 (135 HSPs) |
 |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
| [»] scaffold1185 (1 HSPs) |
 |  |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |  |
|
| [»] scaffold0460 (2 HSPs) |
 |  |  |
|
| [»] scaffold0038 (2 HSPs) |
 |  |
|
| [»] scaffold0288 (1 HSPs) |
 |  |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |
|
| [»] scaffold0517 (1 HSPs) |
 |  |  |
|
| [»] scaffold1372 (1 HSPs) |
 |  |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
| [»] scaffold0864 (1 HSPs) |
 |  |  |
|
| [»] scaffold0394 (1 HSPs) |
 |  |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0330 (1 HSPs) |
 |  |  |
|
| [»] scaffold0063 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |  |
|
| [»] scaffold1709 (1 HSPs) |
 |  |  |
|
| [»] scaffold1331 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold0199 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 110)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 15972495 - 15972669
Alignment:
| Q |
1 |
tatatgtttttatttctccaagtagaataaatagagaaaatcataaacggagagagtcctaacttgtggggagttatcttcc---------------ctc |
85 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
15972495 |
tatatgtctttatttctccaagtggaataaatagagaaaatcataaatggagagagtcctaacttgtggggagttatctcccctctatttaactcctctc |
15972594 |
T |
 |
| Q |
86 |
tatttaagttagaggggaaataactctatttaagttagaagaaattatttatcatctaattcaagtactcttgag |
160 |
Q |
| |
|
||||||| ||||||||||||||| | ||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15972595 |
tatttaaattagaggggaaataattatatttaagttagaagaaattatttaccatctaattcaagtactcttgag |
15972669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 3446730 - 3446780
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3446730 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
3446780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 19281608 - 19281658
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19281608 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
19281658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 19684073 - 19684123
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19684073 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
19684123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 25857365 - 25857315
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25857365 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
25857315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 4183176 - 4183225
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4183176 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
4183225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 22653714 - 22653665
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22653714 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
22653665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 167 - 216
Target Start/End: Original strand, 41509517 - 41509566
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41509517 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
41509566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 166 - 214
Target Start/End: Original strand, 18694785 - 18694833
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagga |
214 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18694785 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagga |
18694833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 168 - 216
Target Start/End: Original strand, 36182644 - 36182692
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36182644 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
36182692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 8250371 - 8250324
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8250371 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
8250324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 33229003 - 33228956
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33229003 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
33228956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 34613979 - 34614026
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34613979 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
34614026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 38400310 - 38400357
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38400310 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
38400357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 44948596 - 44948643
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44948596 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
44948643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 2643697 - 2643747
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2643697 |
cccgtgagcatagctcagttggtagggatattgcatattatatgcaggagc |
2643747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 4562822 - 4562772
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4562822 |
cccgtgagtttagctcagttggtagggatattgcatattatatgcaggagc |
4562772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 6331562 - 6331612
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6331562 |
cccgtgagcatagctcagttggtagggatattgcatattatatgcaggagc |
6331612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 18278487 - 18278437
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18278487 |
cccgtgagtttagctcagttggtagggatattgcatattatatgcaggagc |
18278437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 27297175 - 27297225
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27297175 |
cccgtgagcttagctcagttggtagggatattgcatattgtatgcaggagc |
27297225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 3438948 - 3438997
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3438948 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
3438997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 15764932 - 15764977
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15764932 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
15764977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 17034735 - 17034784
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17034735 |
cccgtgagcttagctcaattggtagggatattgcatattatatgcaggag |
17034784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 17078457 - 17078506
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17078457 |
cccgtgagcttagctcagttggtagggatattgtatattatatgcaggag |
17078506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 30932516 - 30932467
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30932516 |
cccgtgagcttacctcagttggtagggatattgcatattatatgcaggag |
30932467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 33233292 - 33233243
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33233292 |
cccgtgagcttatctcagttggtagggatattgcatattatatgcaggag |
33233243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 44857302 - 44857257
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44857302 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
44857257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 6636034 - 6635990
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6636034 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
6635990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 27913540 - 27913492
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27913540 |
tcccgtgagcttagctcaattggtagggatattgcatattatatgcagg |
27913492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 1844817 - 1844864
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1844817 |
cccgtaagcttagctcagttggtagggatattgcatattatatgcagg |
1844864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 2289610 - 2289657
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2289610 |
cccgtgagcttagctcagttggtaggaatattgcatattatatgcagg |
2289657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 5521290 - 5521243
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5521290 |
cccgtgagcttagctcagttgatagggatattgcatattatatgcagg |
5521243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 11050827 - 11050780
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11050827 |
cccgtgagcttagctcagttggtagggatattacatattatatgcagg |
11050780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 15233413 - 15233460
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15233413 |
cccgtgagcttagctcaattggtagggatattgcatattatatgcagg |
15233460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 165 - 216
Target Start/End: Original strand, 19612714 - 19612765
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19612714 |
tcccgtgagcttagttcagttggtagggatattgcatattatatgtaggagc |
19612765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 211
Target Start/End: Complemental strand, 28195202 - 28195159
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28195202 |
cgtgagcttagctcagttggtagggatattgcatattatatgca |
28195159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 40535519 - 40535472
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40535519 |
cccgtgagcttagctcagttggtacggatattgcatattatatgcagg |
40535472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 41566762 - 41566809
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41566762 |
cccgtgagcttagctcagttggtaggaatattgcatattatatgcagg |
41566809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 1071470 - 1071520
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
1071470 |
cccgtgagcttagctcagttggtatggatattgtatattatatgcaggagc |
1071520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 5474906 - 5474956
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
5474906 |
cccgtgagcttagctcagttggcagggatattgcatattatacgcaggagc |
5474956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 15485662 - 15485712
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
15485662 |
cccgtgagcttagctcagttggtaaggatattgcatattatatgctggagc |
15485712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 20296418 - 20296468
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
20296418 |
cccgtgagcttagctcagttgataaggatattgcatattatatgcaggagc |
20296468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 178 - 216
Target Start/End: Complemental strand, 30390427 - 30390389
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30390427 |
gctcagttggtagggatattgcatattatatgcaggagc |
30390389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 39408760 - 39408710
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39408760 |
cccgtgagcttaactcagttggtagggatattgcatattatatgcaagagc |
39408710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 167 - 209
Target Start/End: Original strand, 41286132 - 41286174
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41286132 |
ccgtgagcttggttcagttggtagggatattgcatattatatg |
41286174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 44822423 - 44822473
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
44822423 |
cccgtgagcttagctcagttggtagggatatcgcattttatatgcaggagc |
44822473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 5003708 - 5003659
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5003708 |
atcctgtgagcttgactcagttggtagggatattgcattttatatgcagg |
5003659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 167 - 212
Target Start/End: Original strand, 17487705 - 17487750
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17487705 |
ccgtgaacttagctcagttggtagggatattgcatattatatgcag |
17487750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 30392898 - 30392853
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30392898 |
tgagcttagctcagttggtagggatattgcatattatatgtaggag |
30392853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 166 - 214
Target Start/End: Original strand, 1260185 - 1260233
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagga |
214 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
1260185 |
cccgtgagcttagctcagttggtagggatattgcatgttatatgtagga |
1260233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 2806572 - 2806528
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
2806572 |
tcccgtgagcttagctcagttggtagggatattgtatattatatg |
2806528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 3287123 - 3287079
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3287123 |
gtgagcttagctcagttggaagggatattgcatattatatgcagg |
3287079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 31223619 - 31223667
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||| ||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
31223619 |
tcccatgagcttagttcagttggtagggatattgcatattatatgcagg |
31223667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 32609256 - 32609212
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32609256 |
ccgtgagcttaactcagttggtagggatattgcatattatatgca |
32609212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 178 - 213
Target Start/End: Original strand, 1500973 - 1501008
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1500973 |
gctcagttggtagggatattgcatattatatgcagg |
1501008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 178 - 213
Target Start/End: Complemental strand, 7281746 - 7281711
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7281746 |
gctcagttggtagggatattgcatattatatgcagg |
7281711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 23405196 - 23405243
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| |||||||||| |
|
|
| T |
23405196 |
cccgtgagcttagctcagttggtagggacattgcataatatatgcagg |
23405243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 211
Target Start/End: Original strand, 27449181 - 27449228
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||| ||||||||| |
|
|
| T |
27449181 |
atcccgtgagcatagctcagttggtagggatattgcattttatatgca |
27449228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 214
Target Start/End: Complemental strand, 28153219 - 28153164
Alignment:
| Q |
160 |
gagtatccc-gtgagcttggctcagttggtagggatattgcatattatatgcagga |
214 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28153219 |
gagtatcccagtgagcttaactcagttggtagggatattgcatgttatatgcagga |
28153164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 28194636 - 28194679
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28194636 |
tgagcttagctcagttgctagggatattgcatattatatgcagg |
28194679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 38525623 - 38525576
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
38525623 |
cccgtgagcttagctcagttggtaaggatattgcattttatatgcagg |
38525576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 44658330 - 44658377
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
44658330 |
cccgtgagcttagctcagttagtaggaatattgcatattatatgcagg |
44658377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 163 - 213
Target Start/End: Original strand, 3301808 - 3301858
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| |||||| |||| |
|
|
| T |
3301808 |
tatcccgtgagcttagctcatttggtagggatattgcattttatatacagg |
3301858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 208
Target Start/End: Original strand, 5062297 - 5062339
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5062297 |
cccgtgagcttaactcagttggtagggatattgcatattatat |
5062339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 169 - 211
Target Start/End: Original strand, 5612957 - 5612999
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
5612957 |
gtgagcttagctcagttggcagggatattgcatattatatgca |
5612999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 212
Target Start/End: Complemental strand, 7379670 - 7379624
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
7379670 |
cccgtgagcttaactcagttggtaaggatattgcatattatatgcag |
7379624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 18803211 - 18803261
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
18803211 |
cccgtgagcttagctcacttggtaggaatattgcatattatatgcaagagc |
18803261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 22718131 - 22718081
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
22718131 |
cccgtgagcttaactcagttggtagggatactgtatattatatgcaggagc |
22718081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 33549124 - 33549074
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
33549124 |
cccgtgagcttagctcagttgatagagatattgtatattatatgcaggagc |
33549074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 36005442 - 36005492
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| | |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36005442 |
cccgtgagcgtaactcaattggtagggatattgcatattatatgcaggagc |
36005492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 179 - 213
Target Start/End: Original strand, 37063533 - 37063567
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37063533 |
ctcagttggtagggatattgcatattatatgcagg |
37063567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 179 - 213
Target Start/End: Complemental strand, 37352550 - 37352516
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37352550 |
ctcagttggtagggatattgcatattatatgcagg |
37352516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 209
Target Start/End: Complemental strand, 40363140 - 40363098
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40363140 |
ccgtgagcttaactcagttggtagggatattgcatattatatg |
40363098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 43936702 - 43936748
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
43936702 |
ccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
43936748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 211
Target Start/End: Complemental strand, 466676 - 466631
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||||| | |||||||||||||||||||| ||||||||||||| |
|
|
| T |
466676 |
cccgtgagcatagctcagttggtagggatattacatattatatgca |
466631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 211
Target Start/End: Complemental strand, 27497598 - 27497553
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||| ||||||||| |
|
|
| T |
27497598 |
cccgtgagcatagctcagttggtagggatattgcatgttatatgca |
27497553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 211
Target Start/End: Complemental strand, 33041933 - 33041888
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
33041933 |
cccgtgagtttaactcagttggtagggatattgcatattatatgca |
33041888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 180 - 213
Target Start/End: Original strand, 38387677 - 38387710
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38387677 |
tcagttggtagggatattgcatattatatgcagg |
38387710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 40864401 - 40864446
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
40864401 |
cgtgagcttagctcagttggtaggaatattgcattttatatgcagg |
40864446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 8742895 - 8742851
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
8742895 |
tcccgtgagcttagctcagttggtagagatattacatattatatg |
8742851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 9330572 - 9330524
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
9330572 |
tcccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
9330524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 209
Target Start/End: Original strand, 32168931 - 32168971
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32168931 |
gtgagcttaactcagttggtagggatattgcatattatatg |
32168971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 38179312 - 38179268
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| || |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38179312 |
gtgagtttagctcagttggtagggatattgcattttatatgcagg |
38179268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 212
Target Start/End: Complemental strand, 16385113 - 16385066
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||| ||||||| |||||||||||| ||||||||||| |||||||||| |
|
|
| T |
16385113 |
tcccatgagcttagctcagttggtatggatattgcattttatatgcag |
16385066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 215
Target Start/End: Original strand, 17089257 - 17089292
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17089257 |
tcagttggtaggaatattgcatattatatgcaggag |
17089292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 213
Target Start/End: Original strand, 22589915 - 22589946
Alignment:
| Q |
182 |
agttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22589915 |
agttggtagggatattgcatattatatgcagg |
22589946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 212
Target Start/End: Complemental strand, 29942193 - 29942150
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
29942193 |
gtgagcttaactcagttagtagggatattgcatattatatgcag |
29942150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 33669736 - 33669779
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
33669736 |
cccgtgagcttaactcagttagtagggatattgcatattatatg |
33669779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 213
Target Start/End: Original strand, 34355733 - 34355768
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34355733 |
gctcagttggtagggatattgtatattatatgcagg |
34355768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 35798096 - 35798049
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
35798096 |
cccgtgagcttaactcagttgttagagatattgcatattatatgcagg |
35798049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 38557293 - 38557246
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||| ||||||||||| |
|
|
| T |
38557293 |
cccgtgagcttaactcagttggtagggatatggcattttatatgcagg |
38557246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 214
Target Start/End: Complemental strand, 44898539 - 44898504
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagga |
214 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44898539 |
ctcagttggtaggaatattgcatattatatgcagga |
44898504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 215
Target Start/End: Complemental strand, 11093859 - 11093809
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||||||| |||| || |||||||||| |||||||||||||||||| |
|
|
| T |
11093859 |
tcccgtgagcttaactcatttagtagggatatcgcatattatatgcaggag |
11093809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 213
Target Start/End: Original strand, 17601092 - 17601126
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17601092 |
ctcagttggtagggatattgcatatcatatgcagg |
17601126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 27016278 - 27016324
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| | |||||||||| |||||||||||||||||| |||| |
|
|
| T |
27016278 |
ccgtgagcttagttcagttggtatggatattgcatattatatacagg |
27016324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 209
Target Start/End: Complemental strand, 29772347 - 29772305
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
29772347 |
ccgtgagcttaacacagttggtagggatattgcatattatatg |
29772305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 209
Target Start/End: Complemental strand, 33222211 - 33222181
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33222211 |
ctcagttggtagggatattgcatattatatg |
33222181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 213
Target Start/End: Complemental strand, 33816473 - 33816439
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
33816473 |
ctcagttggtagagatattgcatattatatgcagg |
33816439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 13606311 - 13606266
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
13606311 |
cgtgagcttagctcagttggtagggatattaagtattatatgcagg |
13606266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 16040243 - 16040288
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| | |||||||||||||||||||||| |||| |||||| |
|
|
| T |
16040243 |
cgtgagcttagttcagttggtagggatattgcatgttatttgcagg |
16040288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 187 - 216
Target Start/End: Complemental strand, 27463751 - 27463722
Alignment:
| Q |
187 |
gtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27463751 |
gtagggatattgcatattatatgcaggagc |
27463722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 40688707 - 40688662
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| ||| ||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
40688707 |
cgtgatcttagctcagttggtagagatattgcattttatatgcagg |
40688662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 179 - 208
Target Start/End: Complemental strand, 42199938 - 42199909
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42199938 |
ctcagttggtagggatattgcatattatat |
42199909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 43895913 - 43895958
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||| ||||||||| |
|
|
| T |
43895913 |
cccgtgagcttagctcagttggtagggatatcacattttatatgca |
43895958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 202
Target Start/End: Original strand, 19958099 - 19958135
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcata |
202 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
19958099 |
cccgtgagcttagctcagttggtagggacattgcata |
19958135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 202
Target Start/End: Original strand, 20919610 - 20919646
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcata |
202 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
20919610 |
cccgtgagcttagctcagttggtagggacattgcata |
20919646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 209
Target Start/End: Complemental strand, 23919544 - 23919504
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
23919544 |
gtgagcttagctcagttggtagggacattgcataatatatg |
23919504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 25932537 - 25932581
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||| |||||| ||||| |
|
|
| T |
25932537 |
ccgtgaacttagctcagttggtagggatattgtatattaaatgca |
25932581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 202
Target Start/End: Original strand, 43214356 - 43214392
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcata |
202 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43214356 |
cccgtgagcttaactcagttggtagggatattgcata |
43214392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 214
Target Start/End: Original strand, 44021074 - 44021122
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagga |
214 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||| |||||| ||||| |
|
|
| T |
44021074 |
cccgtgagcttaactcagttggtaggaatattgcatgttatatacagga |
44021122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 3e-19; HSPs: 149)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 164 - 216
Target Start/End: Complemental strand, 22230506 - 22230454
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22230506 |
atcccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
22230454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 3847681 - 3847731
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3847681 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
3847731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 6371114 - 6371164
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6371114 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
6371164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 26868349 - 26868399
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26868349 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
26868399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 26919538 - 26919488
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26919538 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
26919488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 43147454 - 43147404
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43147454 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
43147404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 43207669 - 43207719
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43207669 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
43207719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 43596895 - 43596945
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43596895 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
43596945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 46105535 - 46105585
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46105535 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
46105585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 46775100 - 46775050
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46775100 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
46775050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 55251421 - 55251371
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55251421 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
55251371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 164 - 216
Target Start/End: Original strand, 3815058 - 3815110
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3815058 |
atcccgtgagcttagcttagttggtagggatattgcatattatatgcaggagc |
3815110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 22788745 - 22788697
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22788745 |
tcccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
22788697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 43978007 - 43978055
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43978007 |
tcccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
43978055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 8965094 - 8965141
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8965094 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
8965141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 24680156 - 24680109
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24680156 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
24680109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 37935861 - 37935908
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37935861 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
37935908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 39023175 - 39023222
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39023175 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
39023222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 164 - 215
Target Start/End: Complemental strand, 40994175 - 40994124
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40994175 |
atcccgtgagcttagctcagttggtagggatattgcatattatatgtaggag |
40994124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 48569246 - 48569199
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48569246 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
48569199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 49901482 - 49901529
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49901482 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
49901529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 4234355 - 4234305
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4234355 |
cccgtgagcttagctcagttgatagggatattgcatattatatgcaggagc |
4234305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 8433693 - 8433643
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8433693 |
cccgtgagcttagctcagttggtagggatattgcatattatatccaggagc |
8433643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 9761115 - 9761165
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9761115 |
cccgtgagcttacctcagttggtagggatattgcatattatatgcaggagc |
9761165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 23705223 - 23705173
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23705223 |
cccgtgagcttagctcagttggtagggatattgcatattacatgcaggagc |
23705173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 30217600 - 30217646
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30217600 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
30217646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 45112181 - 45112131
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45112181 |
cccgtgagcttacctcagttggtagggatattgcatattatatgcaggagc |
45112131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 45126132 - 45126182
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45126132 |
cccgtgagcttagctcagttggtagggatattgtatattatatgcaggagc |
45126182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 55536380 - 55536430
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
55536380 |
cccgtgagcttagctcagttggtaaggatattgcatattatatgcaggagc |
55536430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 4958626 - 4958577
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4958626 |
cccgtgagcttagttcagttggtagggatattgcatattatatgcaggag |
4958577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 27743780 - 27743731
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27743780 |
atcccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
27743731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 167 - 212
Target Start/End: Original strand, 34353780 - 34353825
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34353780 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcag |
34353825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 39697934 - 39697885
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39697934 |
atcccgtgagcttagctcagttgatagggatattgcatattatatgcagg |
39697885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 50457785 - 50457737
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50457785 |
tcccgtgagcttagctcagttggtaaggatattgcatattatatgcagg |
50457737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 3036125 - 3036078
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3036125 |
cccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
3036078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 3764078 - 3764031
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3764078 |
cccgtgagcttagctcagttggtagggatattacatattatatgcagg |
3764031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 11375959 - 11375912
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11375959 |
cccgtgagcttagctcagttgatagggatattgcatattatatgcagg |
11375912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 12504711 - 12504664
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12504711 |
cgtgagcttatctcagttggtagggatattgcatattatatgcaggag |
12504664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 25235867 - 25235820
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25235867 |
cccgtgagcttagcttagttggtagggatattgcatattatatgcagg |
25235820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 39696405 - 39696358
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39696405 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggag |
39696358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 40051622 - 40051665
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40051622 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
40051665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 165 - 216
Target Start/End: Original strand, 42231511 - 42231562
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42231511 |
tcccgtgagcttaactcagttggtaggaatattgcatattatatgcaggagc |
42231562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 44602485 - 44602532
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44602485 |
cccgtgagcttagctcagttggtagggatattgcattttatatgcagg |
44602532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 45849047 - 45849094
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45849047 |
cccgtgagcttagctcagttggtagggatattgcatattttatgcagg |
45849094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 169 - 216
Target Start/End: Original strand, 46582637 - 46582684
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46582637 |
gtgagtttagctcagttggtagggatattgcatattatatgcaggagc |
46582684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 47934142 - 47934095
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47934142 |
cccgtgagcttagctcagttggtagggatatggcatattatatgcagg |
47934095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 55238569 - 55238522
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
55238569 |
cccgtgagcttagcttagttggtagggatattgcatattatatgcagg |
55238522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 55853178 - 55853131
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55853178 |
cccgtgagcttagctcagttggtagagatattgcatattatatgcagg |
55853131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 637099 - 637149
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
637099 |
cccgtgagcttagctcagctggtaggaatattgcatattatatgcaggagc |
637149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 1458088 - 1458038
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||| ||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1458088 |
cccgtaagcttagctcagttgatagggatattgcatattatatgcaggagc |
1458038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 13578534 - 13578488
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13578534 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
13578488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 37251113 - 37251163
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37251113 |
cccgtgagcttaactcagttggtagggatattgcatattttatgcaggagc |
37251163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 49757354 - 49757304
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| | |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49757354 |
cccgtgagcatagctcagttggtaggaatattgcatattatatgcaggagc |
49757304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 212
Target Start/End: Original strand, 52798278 - 52798324
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52798278 |
cccgtgagcttaactcagttggtagggatattgcatattatatgcag |
52798324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 10417287 - 10417242
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10417287 |
tgagcttagctcagttggtagggatattacatattatatgcaggag |
10417242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 211
Target Start/End: Complemental strand, 13264340 - 13264299
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13264340 |
tgagcttcgctcagttggtagggatattgcatattatatgca |
13264299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 172 - 213
Target Start/End: Original strand, 21935483 - 21935524
Alignment:
| Q |
172 |
agcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21935483 |
agcttagctcagttggtagggatattgcatattatatgcagg |
21935524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 179 - 216
Target Start/End: Complemental strand, 23787396 - 23787359
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23787396 |
ctcagttggtagggatattgcatattatatgcaggagc |
23787359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 29771367 - 29771322
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29771367 |
cgtgagcttagctcaattggtagggatattgcatattatatgcagg |
29771322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 35219570 - 35219522
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35219570 |
cccgtgagcttagctcagttggtagggatattgcatatta-atgcaggag |
35219522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 44312856 - 44312807
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44312856 |
atcccgcgagcttagctcagttggtagggatattgcattttatatgcagg |
44312807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 167 - 216
Target Start/End: Complemental strand, 53572396 - 53572347
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53572396 |
ccgtgagcttaactcagttgatagggatattgcatattatatgcaggagc |
53572347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 179 - 215
Target Start/End: Complemental strand, 12167673 - 12167637
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12167673 |
ctcagttggtagggatattgcatattatatgcaggag |
12167637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 15604111 - 15604063
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
15604111 |
tcccgtgagcttagctcagttggtagggatgttgcattttatatgcagg |
15604063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 168 - 216
Target Start/End: Original strand, 20203428 - 20203476
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| ||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
20203428 |
cgtgagcttagctcatttggtagagatattgcatattatatgcaggagc |
20203476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 167 - 215
Target Start/End: Complemental strand, 35207220 - 35207172
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35207220 |
ccgtgagcttaactcagttgatagggatattgcatattatatgcaggag |
35207172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 212
Target Start/End: Complemental strand, 48615544 - 48615496
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
48615544 |
atcccgtgagcataactcagttggtagggatattgcatattatatgcag |
48615496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 165 - 216
Target Start/End: Original strand, 49056773 - 49056825
Alignment:
| Q |
165 |
tcccgtgagcttg-gctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49056773 |
tcccgtgagcttaagctcagttggtagggacattgcatattatatgcaggagc |
49056825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 166 - 210
Target Start/End: Complemental strand, 51512079 - 51512035
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgc |
210 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51512079 |
cccgtgagctgagctcagttggtagggatattgcatattatatgc |
51512035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 216
Target Start/End: Complemental strand, 627049 - 627002
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
627049 |
gtgagtttagctcagttggtagggatattgcatattatatgcaagagc |
627002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 3157287 - 3157240
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3157287 |
cccgtgaacttagctcagttggtaggaatattgcatattatatgcagg |
3157240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 212
Target Start/End: Original strand, 4105726 - 4105773
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
4105726 |
tcccgtgagcttagctcagttgatagggatattgcattttatatgcag |
4105773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 4590246 - 4590293
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4590246 |
cccgtgagtttagctcagttggtagggatattgcatattatatacagg |
4590293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 5165857 - 5165904
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
5165857 |
cccgtgagcttaactcagttggtagggatatcgcatattatatgcagg |
5165904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 7686332 - 7686285
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
7686332 |
cccgtgagcttagctcagttggtagagatattgcattttatatgcagg |
7686285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 10402441 - 10402488
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
10402441 |
cccgtgagcttaactcagttggtagagatattgcatattatatgcagg |
10402488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 15064270 - 15064223
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||| || |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15064270 |
cgtgagtttagctcagttggtaggaatattgcatattatatgcaggag |
15064223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 162 - 213
Target Start/End: Complemental strand, 25175204 - 25175153
Alignment:
| Q |
162 |
gtatcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||| |||||||| | |||||||||||||||||| ||||||||||||||| |
|
|
| T |
25175204 |
gtatcctgtgagcttagttcagttggtagggatattacatattatatgcagg |
25175153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 178 - 213
Target Start/End: Original strand, 30057234 - 30057269
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
30057234 |
gctcagttggtagggatattgcatattatatgcagg |
30057269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 33933809 - 33933762
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| |||||||||| |
|
|
| T |
33933809 |
cccgtgagcttagctcagttggtagggacattgcataatatatgcagg |
33933762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 35465435 - 35465482
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||| |||| |
|
|
| T |
35465435 |
cccgtgagcttagctcagttggtagggatattgcattttatatacagg |
35465482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 45673652 - 45673699
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45673652 |
cccgtgagcttaactcagttggtaggaatattgcatattatatgcagg |
45673699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 50512364 - 50512407
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50512364 |
tgagcttagctcagttggtaggaatattgcatattatatgcagg |
50512407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 52757348 - 52757301
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
52757348 |
cccgtgagcttagctcagttggcaggaatattgcatattatatgcagg |
52757301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 542883 - 542837
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
542883 |
ccgtgagcttagctcagttgatagggatattgcatattgtatgcagg |
542837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 5179952 - 5179902
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||| ||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5179952 |
cccgtgaacttaactcagttggtaaggatattgcatattatatgcaggagc |
5179902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 182 - 216
Target Start/End: Complemental strand, 12582082 - 12582048
Alignment:
| Q |
182 |
agttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
12582082 |
agttggtagggatattgcatattatatgcaggagc |
12582048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 163 - 209
Target Start/End: Complemental strand, 18424970 - 18424924
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18424970 |
tatcccgtgaacttaactcagttggtagggatattgcatattatatg |
18424924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 163 - 209
Target Start/End: Complemental strand, 42381186 - 42381140
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
42381186 |
tatcccgtgaacttagctcagttggtagggatattgcatgttatatg |
42381140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 43271786 - 43271740
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| | ||||||| |||||||||||||||||||||||||| |
|
|
| T |
43271786 |
ccgtgagcttagttcagttgatagggatattgcatattatatgcagg |
43271740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 170 - 216
Target Start/End: Original strand, 49447125 - 49447171
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
49447125 |
tgagcttagctcagttggtaaggatattgcatattatatgtaggagc |
49447171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 179 - 213
Target Start/End: Complemental strand, 56479283 - 56479249
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
56479283 |
ctcagttggtagggatattgcatattatatgcagg |
56479249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 165 - 206
Target Start/End: Complemental strand, 24997505 - 24997464
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattat |
206 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
24997505 |
tcccgtgagcttagctcagttggtagggatattgcattttat |
24997464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 25726378 - 25726337
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25726378 |
ccgtgggcttagctcagttggtagggatattgcatattatat |
25726337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 36132229 - 36132278
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||| || ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
36132229 |
cccgtgagtttagctcaattggtaggaatattgcatattatatgcaggag |
36132278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 207
Target Start/End: Original strand, 42218750 - 42218791
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattata |
207 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
42218750 |
cccgtgaacttagctcagttggtagggatattgcatattata |
42218791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 207
Target Start/End: Original strand, 48798279 - 48798320
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattata |
207 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
48798279 |
cccgtgagcttagctcagttggtagggatattgcattttata |
48798320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 178 - 211
Target Start/End: Original strand, 54534838 - 54534871
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
54534838 |
gctcagttggtagggatattgcatattatatgca |
54534871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 172 - 213
Target Start/End: Complemental strand, 56088018 - 56087977
Alignment:
| Q |
172 |
agcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
56088018 |
agcttagctcagttggtagggatattgcattttatatgcagg |
56087977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 216
Target Start/End: Original strand, 2688114 - 2688146
Alignment:
| Q |
184 |
ttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2688114 |
ttggtagggatattgcatattatatgcaggagc |
2688146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 8848279 - 8848235
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||| |||| |
|
|
| T |
8848279 |
gtgagcttagttcagttggtagggatattgcatattatatacagg |
8848235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 17815492 - 17815448
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| | |||||||||||||||||| ||||||||||||||| |
|
|
| T |
17815492 |
gtgagcttagttcagttggtagggatattacatattatatgcagg |
17815448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 209
Target Start/End: Original strand, 42395230 - 42395270
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
42395230 |
gtgagcttagcttagttggtagggatattgcatattatatg |
42395270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 213
Target Start/End: Complemental strand, 4700996 - 4700961
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4700996 |
gctcagttggtagggatattgtatattatatgcagg |
4700961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 215
Target Start/End: Complemental strand, 10042474 - 10042439
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10042474 |
tcagttggtagggatattgcatattatatgtaggag |
10042439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 216
Target Start/End: Complemental strand, 10407101 - 10407055
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
10407101 |
gtgagcttagctcagttggtagg-atattgcatattatatgtaggagc |
10407055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 12678511 - 12678554
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||| ||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
12678511 |
tgagtttgactcagttggtagagatattgcatattatatgcagg |
12678554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 213
Target Start/End: Complemental strand, 12775297 - 12775262
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12775297 |
gctcagttggtagggatattgcattttatatgcagg |
12775262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 18360493 - 18360540
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
18360493 |
cccgtgagcttagctcagttggtagggatatcacattttatatgcagg |
18360540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 213
Target Start/End: Original strand, 19963798 - 19963829
Alignment:
| Q |
182 |
agttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19963798 |
agttggtagggatattgcatattatatgcagg |
19963829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 209
Target Start/End: Original strand, 31016348 - 31016379
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31016348 |
gctcagttggtagggatattgcatattatatg |
31016379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 209
Target Start/End: Complemental strand, 31852683 - 31852640
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
31852683 |
cccgtgagcttatctcagttggtagggttattgcatattatatg |
31852640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 36602436 - 36602389
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
36602436 |
cccgtgagcttagctcagttggtagggatatcacattttatatgcagg |
36602389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 41137982 - 41137943
Alignment:
| Q |
174 |
cttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
41137982 |
cttggctcagttggtagggacattgcataatatatgcagg |
41137943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 43481109 - 43481062
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
43481109 |
cccgtgagcttaactcagttggtagggatattgcactttatatgcagg |
43481062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 216
Target Start/End: Complemental strand, 46998435 - 46998388
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| |||||||||||| | |||||| ||||||||||||||||| |
|
|
| T |
46998435 |
gtgagcttagctcagttggtatgaatattgtatattatatgcaggagc |
46998388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 213
Target Start/End: Original strand, 55021566 - 55021601
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
55021566 |
gctcagttggtaggaatattgcatattatatgcagg |
55021601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 55055916 - 55055963
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||| | |||||||| |||||||| |
|
|
| T |
55055916 |
cccgtgagcttagctcagttggtagggacaatgcatattttatgcagg |
55055963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 1439617 - 1439663
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||| ||| |||||||||||| ||| ||||||||||||||||| |
|
|
| T |
1439617 |
tcccgtgaacttagctcagttggtatggacattgcatattatatgca |
1439663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 2771037 - 2771083
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| |||||| || || ||||||||||||||||||||||| |
|
|
| T |
2771037 |
ccgtgagcttagctcagctgatatggatattgcatattatatgcagg |
2771083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 3784913 - 3784959
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| | |||||||| |
|
|
| T |
3784913 |
ccgtgagcttagctcaattggtagggatattgcataatttatgcagg |
3784959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 208
Target Start/End: Original strand, 15208522 - 15208564
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
15208522 |
cccgtgagcttaactcagtgggtagggatattgcatattatat |
15208564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 216
Target Start/End: Original strand, 22819428 - 22819458
Alignment:
| Q |
186 |
ggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
22819428 |
ggtagggatattgcatattatatgcaggagc |
22819458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 209
Target Start/End: Complemental strand, 27103170 - 27103128
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||| |||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
27103170 |
ccgtgtgcttagcttagttggtagggatattgcatattatatg |
27103128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 27362898 - 27362852
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
27362898 |
ccgtgagcttaactcagttggtagcgatattacatattatatgcagg |
27362852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 34618283 - 34618329
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||||||||||| |||| |||||||||| ||||||||||| |
|
|
| T |
34618283 |
ccgtgagtttggctcagttcgtagagatattgcattttatatgcagg |
34618329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 209
Target Start/End: Original strand, 38228438 - 38228480
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||| ||||||| |
|
|
| T |
38228438 |
ccgtgagcttagatcagttggtagggatattgcatgttatatg |
38228480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 42134528 - 42134482
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||| ||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
42134528 |
tcccatgagcttaactcagttagtagggatattgcatattatatgca |
42134482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 213
Target Start/End: Original strand, 43905723 - 43905757
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43905723 |
ctcagttggtagggatattgcatgttatatgcagg |
43905757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 213
Target Start/End: Original strand, 47890708 - 47890742
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
47890708 |
ctcagttggtagagatattgcatattatatgcagg |
47890742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 211
Target Start/End: Complemental strand, 50442808 - 50442766
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||| |||||||| |
|
|
| T |
50442808 |
gtgagcttagctcagttggtagggataatgcataatatatgca |
50442766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 52483246 - 52483197
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||| |||| |||||||||||||| |||||| |
|
|
| T |
52483246 |
cccgtgagcttagctcagttggta-ggatgttgcatattatatgtaggagc |
52483197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 216
Target Start/End: Complemental strand, 53634317 - 53634271
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||| | |||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
53634317 |
tgagcttagttcagttcgtagggatattgcatattatatacaggagc |
53634271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 213
Target Start/End: Complemental strand, 54103621 - 54103587
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
54103621 |
ctcagttgatagggatattgcatattatatgcagg |
54103587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 21380252 - 21380203
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||| || ||||| ||| |||||||||||||||||||| ||||||| |
|
|
| T |
21380252 |
cccgtgagtttagctcaattgctagggatattgcatattataagcaggag |
21380203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 209
Target Start/End: Original strand, 33530795 - 33530836
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
33530795 |
cgtgagcttagcttaattggtagggatattgcatattatatg |
33530836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 180 - 213
Target Start/End: Complemental strand, 44195680 - 44195647
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
44195680 |
tcagttggtagggatattgcattttatatgcagg |
44195647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 180 - 213
Target Start/End: Original strand, 46903345 - 46903378
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
46903345 |
tcagttggtatggatattgcatattatatgcagg |
46903378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 51777842 - 51777891
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| || |||||||| |||| ||||||||||||||||||||| |
|
|
| T |
51777842 |
atcccgtgagtttagctcagttagtagctatattgcatattatatgcagg |
51777891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 211
Target Start/End: Complemental strand, 53376749 - 53376704
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||| |||||| ||||| |||||||||||||||||| ||||||||| |
|
|
| T |
53376749 |
cccgcgagcttagctcaattggtagggatattgcatgttatatgca |
53376704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 209
Target Start/End: Original strand, 9661549 - 9661593
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||| || ||||||||||| ||||||||||||||||||| |
|
|
| T |
9661549 |
tcccgtgagtttatctcagttggtatggatattgcatattatatg |
9661593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 13641077 - 13641125
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| | |||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
13641077 |
tcccgtgagcatagctcagctggtagggatatcgcattttatatgcagg |
13641125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 213
Target Start/End: Original strand, 20320456 - 20320488
Alignment:
| Q |
181 |
cagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
20320456 |
cagttggtagggatatcgcatattatatgcagg |
20320488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 208
Target Start/End: Original strand, 21432616 - 21432656
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
||||||||| | ||||||||||| ||||||||||||||||| |
|
|
| T |
21432616 |
cgtgagcttagttcagttggtagagatattgcatattatat |
21432656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 211
Target Start/End: Original strand, 32339337 - 32339369
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
32339337 |
ctcagttgttagggatattgcatattatatgca |
32339369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 37718999 - 37719047
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| |||| ||||||||||| |
|
|
| T |
37718999 |
tcccgtgagcttaactcagttgttagggatatcgcattttatatgcagg |
37719047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 45139952 - 45139904
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||| ||| | |||||||| |
|
|
| T |
45139952 |
tcccgtgagcttagctcagttggtagggacattgtataatttatgcagg |
45139904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 46206580 - 46206624
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||| |||||||||| |
|
|
| T |
46206580 |
gtgagcttagctcagttggtagggacattgcattatatatgcagg |
46206624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 213
Target Start/End: Complemental strand, 54443931 - 54443903
Alignment:
| Q |
185 |
tggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
54443931 |
tggtagggatattgcatattatatgcagg |
54443903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 165 - 216
Target Start/End: Complemental strand, 931 - 880
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
931 |
tcccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 1e-18; HSPs: 119)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 165 - 216
Target Start/End: Original strand, 24781029 - 24781080
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24781029 |
tcccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
24781080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 165 - 216
Target Start/End: Complemental strand, 27510328 - 27510277
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27510328 |
tcccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
27510277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 12640659 - 12640609
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12640659 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
12640609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 29617405 - 29617455
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29617405 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
29617455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 42443689 - 42443739
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42443689 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
42443739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 44616602 - 44616652
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44616602 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
44616652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 2681096 - 2681145
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2681096 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
2681145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 35950128 - 35950177
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35950128 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
35950177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 167 - 216
Target Start/End: Original strand, 36174391 - 36174440
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36174391 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
36174440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 36391974 - 36391925
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36391974 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
36391925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 164 - 216
Target Start/End: Complemental strand, 34267623 - 34267571
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34267623 |
atcccgtgagcttagctcagttggtaggaatattgcatattatatgcaggagc |
34267571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 2228975 - 2229022
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2228975 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
2229022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 9877337 - 9877290
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9877337 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
9877290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 12772117 - 12772164
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12772117 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
12772164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 15238889 - 15238936
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15238889 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
15238936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 19753038 - 19752991
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19753038 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
19752991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 23102628 - 23102581
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23102628 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
23102581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 25833555 - 25833602
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25833555 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
25833602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 3766811 - 3766861
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3766811 |
cccgtgagcttaactcagttggtagggatattgcatattatatgcaggagc |
3766861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 10244959 - 10244909
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10244959 |
cccgtgagcttagctcagttggtagggatattgcatattatatgtaggagc |
10244909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 24061399 - 24061349
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24061399 |
cccgtgagcttagctcagttggtaggaatattgcatattatatgcaggagc |
24061349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 31026219 - 31026269
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31026219 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggagc |
31026269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 170 - 216
Target Start/End: Complemental strand, 32677008 - 32676962
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32677008 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagc |
32676962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 41084040 - 41084086
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41084040 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
41084086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 170 - 216
Target Start/End: Complemental strand, 46534814 - 46534768
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46534814 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagc |
46534768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 47999780 - 47999830
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47999780 |
cccgtgagcttagctcagttggtagggatattgcatattatatgtaggagc |
47999830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 30388575 - 30388530
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30388575 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
30388530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 167 - 216
Target Start/End: Complemental strand, 48288470 - 48288421
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48288470 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcaggagc |
48288421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 168 - 216
Target Start/End: Original strand, 36720109 - 36720157
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36720109 |
cgtgagcttagctcagttggtagggatattgcatattatatacaggagc |
36720157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 41465833 - 41465881
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41465833 |
tcccgtaagcttagctcagttggtagggatattgcatattatatgcagg |
41465881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 5990215 - 5990168
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5990215 |
cccgtgagcttagctcagttggtagggatattgtatattatatgcagg |
5990168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 27424839 - 27424886
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27424839 |
cccgtgagcttagctcagttggaagggatattgcatattatatgcagg |
27424886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 30806115 - 30806162
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30806115 |
cccgtgagtttagctcagttggtagggatattgcatattatatgcagg |
30806162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 209
Target Start/End: Complemental strand, 37300169 - 37300126
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37300169 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
37300126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 38889563 - 38889516
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38889563 |
cccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
38889516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 47641045 - 47641088
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47641045 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
47641088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 9712267 - 9712221
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9712267 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
9712221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 15106758 - 15106712
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15106758 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggag |
15106712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 178 - 216
Target Start/End: Original strand, 21388535 - 21388573
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21388535 |
gctcagttggtagggatattgcatattatatgcaggagc |
21388573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 163 - 209
Target Start/End: Complemental strand, 24062084 - 24062038
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
24062084 |
tatcccgtgagcttagctcagttagtagggatattgcatattatatg |
24062038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 212
Target Start/End: Original strand, 30940771 - 30940817
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30940771 |
cccgtgagcttagctcagttggtagtgatattgcatattatatgcag |
30940817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 32984284 - 32984238
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32984284 |
gtgagcttagctcagttggtagggatattgcatattatatacaggag |
32984238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 36469775 - 36469725
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
36469775 |
cccgtgagcttagctcagttggtagggatattacatattacatgcaggagc |
36469725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 215
Target Start/End: Original strand, 4960788 - 4960833
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4960788 |
tgagcttagctcagttagtagggatattgcatattatatgcaggag |
4960833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 24692475 - 24692524
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24692475 |
cccgtgaggttagctcagttggtagggatattgcatattctatgcaggag |
24692524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 167 - 216
Target Start/End: Complemental strand, 24880521 - 24880472
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24880521 |
ccgtaagcttagctcagttggtagggatattgaatattatatgcaggagc |
24880472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 178 - 215
Target Start/End: Complemental strand, 33996939 - 33996902
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33996939 |
gctcagttggtagggatattgcatattatatgcaggag |
33996902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 161 - 213
Target Start/End: Original strand, 48119464 - 48119517
Alignment:
| Q |
161 |
agtatccc-gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48119464 |
agtatccctgtgagcttagctcagttggtagggatattgcattttatatgcagg |
48119517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 18223788 - 18223744
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18223788 |
tcccgtgagcttaactcagttggtagggatattgcatattatatg |
18223744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 168 - 212
Target Start/End: Original strand, 29625923 - 29625967
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29625923 |
cgtgagcttaactcagttggtagggatattgcatattatatgcag |
29625967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 163 - 215
Target Start/End: Complemental strand, 31769585 - 31769533
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| | | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31769585 |
tatcccgtgagataagttcagttggtagggatattgcatattatatgcaggag |
31769533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 35683198 - 35683150
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
35683198 |
tcccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
35683150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 178 - 213
Target Start/End: Complemental strand, 1563797 - 1563762
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1563797 |
gctcagttggtagggatattgcatattatatgcagg |
1563762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 21066886 - 21066929
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
21066886 |
cccgtgagtttagctcagttggtagggatattgcatattatatg |
21066929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 28805304 - 28805347
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28805304 |
tgagcttagctcagttggtagggatattgcatatcatatgcagg |
28805347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 35815838 - 35815885
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
35815838 |
cccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
35815885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 36389736 - 36389689
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| || ||||||||||| |
|
|
| T |
36389736 |
cccgtgagcttagctcagttggtagggatattgtattttatatgcagg |
36389689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 212
Target Start/End: Complemental strand, 9929974 - 9929928
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9929974 |
cccgttagcttagctcagttggtagggatattgaatattatatgcag |
9929928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 12264055 - 12264101
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12264055 |
ccgtgaacttagctcagttggtagggatattgcattttatatgcagg |
12264101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 24188471 - 24188517
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| | |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24188471 |
ccgtgagcatagctcagttggtagggatactgcatattatatgcagg |
24188517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 178 - 216
Target Start/End: Complemental strand, 26801787 - 26801749
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26801787 |
gctcagttggtaggaatattgcatattatatgcaggagc |
26801749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 178 - 216
Target Start/End: Original strand, 35645611 - 35645649
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35645611 |
gctcagttggtagggatattgtatattatatgcaggagc |
35645649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 38824694 - 38824648
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
38824694 |
ccgtgagcttagctcagttgatagggatattgcgtattatatgcagg |
38824648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 169 - 211
Target Start/End: Original strand, 39098139 - 39098181
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
39098139 |
gtgagcttagttcagttggtagggatattgcatattatatgca |
39098181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 42182267 - 42182221
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
42182267 |
ccgtgagcttaactcagttggtaggggtattgcatattatatgcagg |
42182221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 178 - 216
Target Start/End: Original strand, 48719811 - 48719849
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48719811 |
gctcagttggtaggaatattgcatattatatgcaggagc |
48719849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 10691 - 10646
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| ||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10691 |
cgtgatcttagcttagttggtagggatattgcatattatatgcagg |
10646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 5833039 - 5833084
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||| |||||||| |
|
|
| T |
5833039 |
cccgtgagcttagctcagttggtagggataatgcataatatatgca |
5833084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 179 - 216
Target Start/End: Original strand, 8174129 - 8174166
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8174129 |
ctcagttggtagggatattgcattttatatgcaggagc |
8174166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 211
Target Start/End: Complemental strand, 26816728 - 26816683
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||| |||||||| |
|
|
| T |
26816728 |
cccgtgagcttagctcagttggtagggataatgcataatatatgca |
26816683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 36622174 - 36622219
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||| ||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
36622174 |
cccgtgaacttagctcaattggtagggatattgcatattatatgca |
36622219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 13730164 - 13730120
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| ||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
13730164 |
gtgagcttagcttagttggtagagatattgcatattatatgcagg |
13730120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 209
Target Start/End: Complemental strand, 24732618 - 24732578
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
24732618 |
gtgagcttagctcagttgttagggatattgcatattatatg |
24732578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 31191671 - 31191623
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
31191671 |
tcccgtgagcttaattcagttggtaaggatattgcatattatatgcagg |
31191623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 32856988 - 32856940
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| ||| ||| | |||||||||||||||||||||||||||||| |
|
|
| T |
32856988 |
tcccgtgaacttagcttaattggtagggatattgcatattatatgcagg |
32856940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 212
Target Start/End: Complemental strand, 35612639 - 35612591
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||| ||||||| ||||| |||||||||| |||||||||||||||||| |
|
|
| T |
35612639 |
atcccatgagcttagctcaattggtagggagattgcatattatatgcag |
35612591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 216
Target Start/End: Complemental strand, 47255154 - 47255102
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||| ||||||||| || ||||||||||||||| ||||||||| |
|
|
| T |
47255154 |
atcccgtgagcttaactcagttggcagagatattgcatattatctgcaggagc |
47255102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 5073267 - 5073314
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
5073267 |
cccgtgagcttaactcagttggtagagatattgtatattatatgcagg |
5073314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 179 - 214
Target Start/End: Complemental strand, 7401444 - 7401409
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagga |
214 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7401444 |
ctcagttggtagggatattgtatattatatgcagga |
7401409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 7525444 - 7525491
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| || | |||||||||| ||||||||||||||||||||||| |
|
|
| T |
7525444 |
cccgtgagtttagttcagttggtaaggatattgcatattatatgcagg |
7525491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 9233832 - 9233785
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || ||||||||||| |
|
|
| T |
9233832 |
cccgtgagcttaactcagttggtagggatattgaattttatatgcagg |
9233785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 10226675 - 10226722
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| || | ||||||||||||||| |||||||||||||||||| |
|
|
| T |
10226675 |
cccgtgagtttagttcagttggtagggatgttgcatattatatgcagg |
10226722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 12615755 - 12615798
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
12615755 |
tgagcttaactcagttgatagggatattgcatattatatgcagg |
12615798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 213
Target Start/End: Original strand, 13720782 - 13720817
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13720782 |
gctcagttggttgggatattgcatattatatgcagg |
13720817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 213
Target Start/End: Complemental strand, 15074960 - 15074925
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15074960 |
gctcagttgatagggatattgcatattatatgcagg |
15074925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 15655708 - 15655751
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
15655708 |
tgagcttagctcaattggtagggatattgcattttatatgcagg |
15655751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 15694550 - 15694597
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
15694550 |
cccgtgagcttaattcagttggtagggatattgtatattatatgcagg |
15694597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 15701530 - 15701577
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
15701530 |
cccgtgagcttaattcagttggtagggatattgtatattatatgcagg |
15701577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 21762962 - 21762915
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21762962 |
cccgtgaacttatctcagttggtaaggatattgcatattatatgcagg |
21762915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 23755084 - 23755037
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||| | ||||||||||||||||||| |||||||| |
|
|
| T |
23755084 |
cccgtgagcttagctcaatcggtagggatattgcatattttatgcagg |
23755037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 213
Target Start/End: Original strand, 27633947 - 27633978
Alignment:
| Q |
182 |
agttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27633947 |
agttggtagggatattgcatattatatgcagg |
27633978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 211
Target Start/End: Complemental strand, 27679078 - 27679035
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
27679078 |
cgtgagcttaactcagttggtatggatattgcatattatatgca |
27679035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 27704369 - 27704322
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27704369 |
cccgtgaacttaactcagttggtaggaatattgcatattatatgcagg |
27704322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 32074465 - 32074418
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
32074465 |
cccgtgagcttagctcagttggtagggatatcacattttatatgcagg |
32074418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 167 - 214
Target Start/End: Original strand, 41699640 - 41699687
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagga |
214 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| ||||| |||| |
|
|
| T |
41699640 |
ccgtgagcttagctcagttagtagggatattgcatatcatatgtagga |
41699687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 42352650 - 42352697
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||| || |||||||||| |
|
|
| T |
42352650 |
cccgtgagctttgctcagttggtagggacattgcctaatatatgcagg |
42352697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 216
Target Start/End: Complemental strand, 44593553 - 44593502
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||| ||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
44593553 |
tcccgtgagcttaactcagttaatagagatattgcatattatatgcaggagc |
44593502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 216
Target Start/End: Complemental strand, 48413993 - 48413946
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| ||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
48413993 |
gtgagcttagctcaattggcagagatattgcatattatatgcaggagc |
48413946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 213
Target Start/End: Complemental strand, 1398960 - 1398926
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
1398960 |
ctcagttggttgggatattgcatattatatgcagg |
1398926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 15716756 - 15716710
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||| |||| || |||||||||||||||||||||| ||||||||||| |
|
|
| T |
15716756 |
tcccatgagtttagctcagttggtagggatattgcgtattatatgca |
15716710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 207
Target Start/End: Original strand, 28735731 - 28735769
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattata |
207 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28735731 |
gtgagcttaactcagttggtagggatattgcatattata |
28735769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 32619350 - 32619400
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||| || ||||||||||||||||||| |||||| |
|
|
| T |
32619350 |
cccgtgagcttaactcagttgttaaggatattgcatattatatgtaggagc |
32619400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 180 - 213
Target Start/End: Original strand, 3532592 - 3532625
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
3532592 |
tcagttggtagggatattgcataatatatgcagg |
3532625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 7876001 - 7876046
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||| | |||||||| |
|
|
| T |
7876001 |
cgtgagcttagctcagttggtagggacattgcataatttatgcagg |
7876046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 19331567 - 19331518
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| | ||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
19331567 |
cccgtgagcttagtgcagttggtacggatattgcattttatatgcaggag |
19331518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 167 - 212
Target Start/End: Original strand, 19828127 - 19828172
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||| ||| ||||||||||||||||||| |||| |||||||||| |
|
|
| T |
19828127 |
ccgtgaacttagctcagttggtagggatatcgcattttatatgcag |
19828172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 180 - 209
Target Start/End: Original strand, 24508840 - 24508869
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24508840 |
tcagttggtagggatattgcatattatatg |
24508869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 180 - 213
Target Start/End: Complemental strand, 34051930 - 34051897
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
34051930 |
tcagttggtagtgatattgcatattatatgcagg |
34051897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 165 - 210
Target Start/End: Complemental strand, 42798387 - 42798342
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgc |
210 |
Q |
| |
|
|||||||||||| | ||||| |||||||||||||||||||||||| |
|
|
| T |
42798387 |
tcccgtgagcttaacccagtttgtagggatattgcatattatatgc |
42798342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 171 - 216
Target Start/End: Complemental strand, 43633155 - 43633110
Alignment:
| Q |
171 |
gagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||| ||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
43633155 |
gagcttagctcagttgatagggatattatatattatatgcaggagc |
43633110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 16200562 - 16200606
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| ||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
16200562 |
gtgagcttagcttaattggtaggaatattgcatattatatgcagg |
16200606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 212
Target Start/End: Complemental strand, 16961692 - 16961648
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||| || ||||||||||||||||||||| || |||||||||| |
|
|
| T |
16961692 |
cgtgagtttagctcagttggtagggatattgtattttatatgcag |
16961648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 211
Target Start/End: Original strand, 30681421 - 30681457
Alignment:
| Q |
175 |
ttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
30681421 |
ttggctcaattgatagggatattgcatattatatgca |
30681457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 201
Target Start/End: Original strand, 38151347 - 38151379
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcat |
201 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
38151347 |
gtgagcttagctcagttggtagggatattgcat |
38151379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 40200180 - 40200132
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||| ||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
40200180 |
tcccgtaagcttaactcagttggtagaaatattgcatattatatgcagg |
40200132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 44377112 - 44377068
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
44377112 |
gtgagcttaactcagttggtagagatattacatattatatgcagg |
44377068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 44385979 - 44385935
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
44385979 |
gtgagcttaactcagttggtagagatattacatattatatgcagg |
44385935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 214
Target Start/End: Complemental strand, 45640162 - 45640114
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagga |
214 |
Q |
| |
|
||||||||||| || |||| |||||||||||| ||||||||||||||| |
|
|
| T |
45640162 |
cccgtgagcttaacttagttagtagggatattgtatattatatgcagga |
45640114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 49053998 - 49054042
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| | |||||||||| | ||||||||||||||||||||| |
|
|
| T |
49053998 |
gtgagcttagttcagttggtacgaatattgcatattatatgcagg |
49054042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 1e-18; HSPs: 122)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 165 - 216
Target Start/End: Original strand, 35515511 - 35515562
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35515511 |
tcccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
35515562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 1743127 - 1743177
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1743127 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
1743177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 4417755 - 4417705
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4417755 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
4417705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 6518846 - 6518796
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6518846 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
6518796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 9835033 - 9835083
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9835033 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
9835083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 12463756 - 12463806
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12463756 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
12463806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 21918052 - 21918102
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21918052 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
21918102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 32505688 - 32505738
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32505688 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
32505738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 41179873 - 41179823
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41179873 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
41179823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 167 - 216
Target Start/End: Original strand, 8968750 - 8968799
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8968750 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
8968799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 11897248 - 11897297
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11897248 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
11897297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 27765257 - 27765306
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27765257 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
27765306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 42320317 - 42320366
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42320317 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
42320366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 43580875 - 43580928
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43580875 |
tatcccgtgaacttagctcagttggtagggatattgcatattatatgcaggagc |
43580928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 17545242 - 17545195
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17545242 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
17545195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 162 - 213
Target Start/End: Complemental strand, 23292491 - 23292440
Alignment:
| Q |
162 |
gtatcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23292491 |
gtatcccgtgagcttagctcagttggtagggatattgcatgttatatgcagg |
23292440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 2328592 - 2328642
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2328592 |
cccgtgagcttagcttagttggtagggatattgcatattatatgcaggagc |
2328642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 4745946 - 4745896
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4745946 |
cccgtgagcttagctcagttggtagggatattgcatattatatgaaggagc |
4745896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 5966829 - 5966879
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5966829 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggagc |
5966879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 12767964 - 12768014
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12767964 |
cccgtgagcttagttcagttggtagggatattgcatattatatgcaggagc |
12768014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 170 - 216
Target Start/End: Complemental strand, 16386807 - 16386761
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16386807 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagc |
16386761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 212
Target Start/End: Original strand, 16603398 - 16603444
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16603398 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcag |
16603444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 212
Target Start/End: Complemental strand, 25472653 - 25472607
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25472653 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcag |
25472607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 25648155 - 25648105
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25648155 |
cccgtgagcttagctcagttggtagggatattgcatattacatgcaggagc |
25648105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 39919163 - 39919113
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39919163 |
cccgtgagcttagcttagttggtagggatattgcatattatatgcaggagc |
39919113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 42525400 - 42525450
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42525400 |
cccgtgagtttagctcagttggtagggatattgcatattatatgcaggagc |
42525450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 21749447 - 21749398
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21749447 |
cccgtgagcttagctcagttggtagggatactgcatattatatgcaggag |
21749398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 36888465 - 36888416
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36888465 |
cccgtgagcttagttcagttggtagggatattgcatattatatgcaggag |
36888416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 17666005 - 17666053
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17666005 |
tcccgtgagcttagctcagttggtaggaatattgcatattatatgcagg |
17666053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 5900292 - 5900339
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5900292 |
cccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
5900339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 6558801 - 6558848
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6558801 |
cccgtgagcttagctcaattggtagggatattgcatattatatgcagg |
6558848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 9125663 - 9125710
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9125663 |
cccgtgagcttagctcagttggtagcgatattgcatattatatgcagg |
9125710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 12891557 - 12891600
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12891557 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
12891600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 13622016 - 13621969
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13622016 |
cccgtgagcttagctcagttggtagggatatcgcatattatatgcagg |
13621969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 18815348 - 18815395
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18815348 |
cccgtgagcttagctcagttggtaaggatattgcatattatatgcagg |
18815395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 169 - 216
Target Start/End: Complemental strand, 25400434 - 25400387
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25400434 |
gtgagcatagctcagttggtagggatattgcatattatatgcaggagc |
25400387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 546803 - 546849
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
546803 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
546849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 10241726 - 10241772
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10241726 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
10241772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 11774529 - 11774479
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||| ||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11774529 |
cccgtgaccttagctcagtttgtagggatattgcatattatatgcaggagc |
11774479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 14641179 - 14641129
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14641179 |
cccgtgagcttaactcaattggtagggatattgcatattatatgcaggagc |
14641129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 212
Target Start/End: Complemental strand, 29713446 - 29713400
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
29713446 |
cccgtgagcttagctcagttggtagggatattgcctattatatgcag |
29713400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 32706322 - 32706372
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
32706322 |
cccgtgagcttagctcagttggtagggatattacatattatatggaggagc |
32706372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 39886282 - 39886232
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39886282 |
cccgtgagcatagctcagttggtagggatattgcatattatatgtaggagc |
39886232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 40091477 - 40091527
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40091477 |
cccgtgagcttaactcagttggtagggatattgcatattatatgcaagagc |
40091527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 2362971 - 2363016
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2362971 |
cgtgagcttaactcagttggtagggatattgcatattatatgcagg |
2363016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 2848213 - 2848258
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
2848213 |
cccgtgagcttagctcagttggtagggatattgtatattatatgca |
2848258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 6414070 - 6414115
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6414070 |
cgtgagcttaactcagttggtagggatattgcatattatatgcagg |
6414115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 211
Target Start/End: Original strand, 8241054 - 8241095
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8241054 |
tgagcttagctcagttggtagggatattgcatattatatgca |
8241095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 167 - 216
Target Start/End: Original strand, 39165018 - 39165067
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||| || | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39165018 |
ccgtgagtttagttcagttggtagggatattgcatattatatgcaggagc |
39165067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 178 - 215
Target Start/End: Complemental strand, 42718879 - 42718842
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42718879 |
gctcagttggtagggatattgcatattatatgcaggag |
42718842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 8750972 - 8750924
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| | | |||||||||||||||||||||||||||||||| |
|
|
| T |
8750972 |
tcccgtgagcttagttaagttggtagggatattgcatattatatgcagg |
8750924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 19985499 - 19985547
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19985499 |
tcccgtgaccttagctcagttggtagggatattgcataatatatgcagg |
19985547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 35113033 - 35112985
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| | ||||||| |||||||||||||||||||||||||| |
|
|
| T |
35113033 |
tcccgtgagcttagttcagttgatagggatattgcatattatatgcagg |
35112985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 40361648 - 40361604
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
40361648 |
ccgtgagtttagctcagttggtagggatattgcatattatatgca |
40361604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 831592 - 831639
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
831592 |
cccgtgagcttagctctgttggtagggatatttcatattatatgcagg |
831639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 988714 - 988765
Alignment:
| Q |
166 |
cccgtgagcttggctcagtt-ggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
988714 |
cccgtgagcttaactcagtttggtagggatattgcatattatatgcaggagc |
988765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 1269237 - 1269190
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
1269237 |
cccgtgagcttagctcaattggtagagatattgcatattatatgcagg |
1269190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 3198327 - 3198374
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| |||||||||| |
|
|
| T |
3198327 |
cccgtgagcttagctcagttggtagggacattgcataatatatgcagg |
3198374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 8478963 - 8478916
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| || | |||||||||||||||||||||||||||||||||| |
|
|
| T |
8478963 |
cccgtgagtttagttcagttggtagggatattgcatattatatgcagg |
8478916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 215
Target Start/End: Original strand, 10404133 - 10404176
Alignment:
| Q |
172 |
agcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10404133 |
agcttagctcagttggtaggaatattgcatattatatgcaggag |
10404176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 11188752 - 11188705
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
11188752 |
cccgtgagcttagctcagttgataggaatattgcatattatatgcagg |
11188705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 15241396 - 15241443
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
15241396 |
cccgtgagcttagctcagttgataggaatattgcatattatatgcagg |
15241443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 24033077 - 24033124
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24033077 |
cccgcgagcttagctcagttggtagggatattgcattttatatgcagg |
24033124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 25729510 - 25729463
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
25729510 |
cccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
25729463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 216
Target Start/End: Original strand, 27798624 - 27798671
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27798624 |
gtgagcatagctcagttggtagggatattgcatattatatgcaagagc |
27798671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 216
Target Start/End: Original strand, 29154846 - 29154893
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
29154846 |
gtgagcttagctcagttggtagggatagtgcatattatatgtaggagc |
29154893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 178 - 213
Target Start/End: Original strand, 30571166 - 30571201
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
30571166 |
gctcagttggtagggatattgcatattatatgcagg |
30571201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 33736084 - 33736037
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33736084 |
cccgggagcttaactcagttggtagggatattgcatattatatgcagg |
33736037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 41477428 - 41477381
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
41477428 |
cccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
41477381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 42916389 - 42916436
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| || ||||||||||| |
|
|
| T |
42916389 |
cccgtgagcttagctcagttggtagggatattgtatgttatatgcagg |
42916436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 11786129 - 11786083
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11786129 |
ccgtgagcttaactcagttggtagggatattgcattttatatgcagg |
11786083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 178 - 216
Target Start/End: Original strand, 28308246 - 28308284
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28308246 |
gctcagttggtagggatattgcatattatatgcaagagc |
28308284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 35241397 - 35241443
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
35241397 |
ccgtgagcttagttcagttggtagagatattgcatattatatgcagg |
35241443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 36124400 - 36124446
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
36124400 |
ccgtgagcttagctcagttgataggaatattgcatattatatgcagg |
36124446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 170 - 216
Target Start/End: Original strand, 41156332 - 41156378
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||| |||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
41156332 |
tgagcttagctcggttgatagggatattgcatattatatgcaggagc |
41156378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 16891348 - 16891393
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||| |||| |
|
|
| T |
16891348 |
cgtgagcttagctcagttggtagggatattgcattttatatacagg |
16891393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 17064926 - 17064881
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
17064926 |
cgtgagcttaactcaattggtagggatattgcatattatatgcagg |
17064881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 180 - 213
Target Start/End: Original strand, 29045901 - 29045934
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29045901 |
tcagttggtagggatattgcatattatatgcagg |
29045934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 40276510 - 40276465
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40276510 |
cgtgagtttagctcagttggtaggaatattgcatattatatgcagg |
40276465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 42158879 - 42158924
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
|||||||||| ||| |||||||| |||||||||||||||||||||| |
|
|
| T |
42158879 |
tatcccgtgaacttagctcagtttgtagggatattgcatattatat |
42158924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 1670393 - 1670441
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
1670393 |
tcccgtgagcttatatcagttggtagggatatggcatattatatgcagg |
1670441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 18928723 - 18928767
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| | |||||||| |
|
|
| T |
18928723 |
gtgagcttagctcagttggtagggatattgcataatttatgcagg |
18928767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 4067982 - 4068029
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||| | |||||||| |||||||| |
|
|
| T |
4067982 |
cccgtgagcttagctcagttggtagggacaatgcatattttatgcagg |
4068029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 212
Target Start/End: Original strand, 6119866 - 6119909
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| |||||||||| |
|
|
| T |
6119866 |
gtgagcttagctcagttggaagggatattgcattttatatgcag |
6119909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 6526050 - 6526097
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| || ||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
6526050 |
cccgtgagtttagctcagttggtagagatattggatattatatgcagg |
6526097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 16971622 - 16971669
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
16971622 |
cccgtgagcttagctcagttggtagagatattgtatattataggcagg |
16971669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 18755984 - 18756035
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||||| |||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
18755984 |
atcccgtgagcttaactcagttggtagagatatcgcattttatatgcaggag |
18756035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 213
Target Start/End: Complemental strand, 19273260 - 19273225
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19273260 |
gctcagttggtagggatattgcatgttatatgcagg |
19273225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 208
Target Start/End: Complemental strand, 22569311 - 22569272
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
22569311 |
gtgagcttagctcagttggtaggcatattgcatattatat |
22569272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 24132937 - 24132984
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||| ||| |||||||| ||||||||||||| |
|
|
| T |
24132937 |
cccgtgagcttagctcagttgatagagatattgcgtattatatgcagg |
24132984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 24477825 - 24477872
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| |||||||||| |
|
|
| T |
24477825 |
cccgtgagcttagctcagttggtagggacgttgcataatatatgcagg |
24477872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 26912833 - 26912876
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
26912833 |
cccgtgagcttaactcaattggtagggatattgcatattatatg |
26912876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 32423565 - 32423612
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
32423565 |
cccgtgagcttaactcagttgttagggatattgtatattatatgcagg |
32423612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 36716924 - 36716881
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36716924 |
tgagcttaactcagctggtagggatattgcatattatatgcagg |
36716881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 211
Target Start/End: Complemental strand, 39028101 - 39028058
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||| || ||||| |||||||||||||||||||||||||||| |
|
|
| T |
39028101 |
cgtgagattagctcatttggtagggatattgcatattatatgca |
39028058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 40081878 - 40081925
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||| |||||| ||| ||||||||||| |
|
|
| T |
40081878 |
cccgtgagcttagctcagttggtagagatattacatcttatatgcagg |
40081925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 209
Target Start/End: Original strand, 1469726 - 1469768
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||| || ||||||||||||| |||||||||||||||||| |
|
|
| T |
1469726 |
ccgtgagtttagctcagttggtagagatattgcatattatatg |
1469768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 212
Target Start/End: Complemental strand, 3712136 - 3712090
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||| ||||| ||||||||||||| |||||||||| |||||||||| |
|
|
| T |
3712136 |
cccgtaagcttagctcagttggtagagatattgcattttatatgcag |
3712090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 4393857 - 4393903
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| | ||||||||||||||| |||||| ||||||||||| |
|
|
| T |
4393857 |
ccgtgagcttagttcagttggtagggatgttgcattttatatgcagg |
4393903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 213
Target Start/End: Complemental strand, 17175108 - 17175074
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17175108 |
ctcagttggtagggatattgcatgttatatgcagg |
17175074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 213
Target Start/End: Original strand, 18638603 - 18638645
Alignment:
| Q |
171 |
gagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||| ||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
18638603 |
gagcttagctcagttggtagggatatcgcattttatatgcagg |
18638645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 21962175 - 21962125
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||| ||||||||| ||||| |
|
|
| T |
21962175 |
cccgtgagcttaactcagttggcagggatattgcaaattatatgcgggagc |
21962125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 27241642 - 27241688
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| |||||||| ||||| ||||| ||||||||||||||| |
|
|
| T |
27241642 |
ccgtgagcttagctcagtttgtaggaatattacatattatatgcagg |
27241688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 31074197 - 31074147
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||| ||||||| |||||| |
|
|
| T |
31074197 |
cccgtgagcttaactcagttggtagggatattacattttatatgtaggagc |
31074147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 216
Target Start/End: Original strand, 37034810 - 37034856
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||| ||||| ||||||||||||| |||| |||||||||||||| |
|
|
| T |
37034810 |
tgagcttagctcaattggtagggatatcgcattttatatgcaggagc |
37034856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 109 - 151
Target Start/End: Original strand, 38016960 - 38017002
Alignment:
| Q |
109 |
ctctatttaagttagaagaaattatttatcatctaattcaagt |
151 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
38016960 |
ctctagttaagttaggagaaattatttatcatctcattcaagt |
38017002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 213
Target Start/End: Original strand, 38097285 - 38097319
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38097285 |
ctcagttggtatggatattgcatattatatgcagg |
38097319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 209
Target Start/End: Original strand, 42885830 - 42885872
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||| ||| ||||||||| |||||||||||||||||| |
|
|
| T |
42885830 |
ccgtgagcttagctaagttggtagagatattgcatattatatg |
42885872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 180 - 213
Target Start/End: Complemental strand, 4238364 - 4238331
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
4238364 |
tcagttggtatggatattgcatattatatgcagg |
4238331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 179 - 212
Target Start/End: Complemental strand, 7845070 - 7845037
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
7845070 |
ctcagttgctagggatattgcatattatatgcag |
7845037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 179 - 216
Target Start/End: Complemental strand, 11815666 - 11815629
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11815666 |
ctcagttgaaagggatattgcatattatatgcaggagc |
11815629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 19891494 - 19891449
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
19891494 |
cgtgagcttaactcagttggtaaggatattgcattttatatgcagg |
19891449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 178 - 215
Target Start/End: Complemental strand, 32389692 - 32389655
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
32389692 |
gctcagttggtagagatattgcatattatatgtaggag |
32389655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 182 - 215
Target Start/End: Original strand, 37182559 - 37182592
Alignment:
| Q |
182 |
agttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
37182559 |
agttggtagggatatcgcatattatatgcaggag |
37182592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 42842945 - 42842904
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| ||||||||| |
|
|
| T |
42842945 |
ccgtgagcttagctcagttggtagagatattgtatattatat |
42842904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 6291945 - 6291905
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatat |
203 |
Q |
| |
|
|||||||||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
6291945 |
tatcccgtgaacttagctcagttggtaggcatattgcatat |
6291905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 202
Target Start/End: Complemental strand, 18049691 - 18049655
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcata |
202 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
18049691 |
cccgtgagcttagctcaattggtagggatattgcata |
18049655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 208
Target Start/End: Complemental strand, 20370192 - 20370152
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||| ||||| |
|
|
| T |
20370192 |
cgtgagcttagctcagttggtagggataatgcataatatat |
20370152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 22229029 - 22228985
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| || |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
22229029 |
gtgagtttagctcagttggtatggatattgcatgttatatgcagg |
22228985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 213
Target Start/End: Complemental strand, 40098797 - 40098757
Alignment:
| Q |
173 |
gcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||| ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
40098797 |
gcttagctcagttgttaggaatattgcatattatatgcagg |
40098757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 213
Target Start/End: Complemental strand, 41319506 - 41319474
Alignment:
| Q |
181 |
cagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
41319506 |
cagttggtagggatattgcattttatatgcagg |
41319474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 41930104 - 41930152
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| ||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
41930104 |
tcccgtgaacttaactcagttgatagggatattgcattttatatgcagg |
41930152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 150)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 165 - 216
Target Start/End: Original strand, 4138999 - 4139050
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4138999 |
tcccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
4139050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 882389 - 882439
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
882389 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
882439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 6920033 - 6919983
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6920033 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
6919983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 7269955 - 7270005
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7269955 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
7270005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 19550506 - 19550556
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19550506 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
19550556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 31327571 - 31327521
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31327571 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
31327521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 31327788 - 31327738
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31327788 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
31327738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 37800681 - 37800631
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37800681 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
37800631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 40548303 - 40548353
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40548303 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
40548353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 40933901 - 40933851
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40933901 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
40933851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 44652052 - 44652002
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44652052 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
44652002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 45701344 - 45701394
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45701344 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
45701394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 50496884 - 50496834
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50496884 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
50496834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 52410311 - 52410261
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52410311 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
52410261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 164 - 216
Target Start/End: Complemental strand, 9176658 - 9176606
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9176658 |
atcccgtgagcttagctcagttggtagggatattgcatattatatgcaagagc |
9176606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 47098731 - 47098779
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47098731 |
tcccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
47098779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 169 - 216
Target Start/End: Complemental strand, 5636866 - 5636819
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5636866 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
5636819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 169 - 216
Target Start/End: Original strand, 15975155 - 15975202
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15975155 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
15975202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 19999867 - 19999914
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19999867 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
19999914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 22502001 - 22501954
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22502001 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
22501954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 28550389 - 28550342
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550389 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
28550342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 165 - 216
Target Start/End: Original strand, 32828440 - 32828491
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32828440 |
tcccgtgagcttagctcggttggtagggatattgcatattatatgcaggagc |
32828491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 39966144 - 39966097
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39966144 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
39966097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 52945895 - 52945942
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52945895 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
52945942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 53347360 - 53347313
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
53347360 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
53347313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 2522926 - 2522976
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2522926 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaagagc |
2522976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 7920320 - 7920370
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7920320 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaagagc |
7920370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 10176973 - 10176923
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10176973 |
cccgtgaggttagctcagttggtagggatattgcatattatatgcaggagc |
10176923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 10482923 - 10482873
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10482923 |
cccgtgaacttagctcagttggtagggatattgcatattatatgcaggagc |
10482873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 18194338 - 18194388
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18194338 |
cccgtgagtttagctcagttggtagggatattgcatattatatgcaggagc |
18194388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 212
Target Start/End: Original strand, 40192156 - 40192202
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40192156 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcag |
40192202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 50234124 - 50234174
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50234124 |
cccgtgagcttacctcagttggtagggatattgcatattatatgcaggagc |
50234174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 52974123 - 52974073
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52974123 |
cccgtgagcttaactcagttggtagggatattgcatattatatgcaggagc |
52974073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 3894541 - 3894594
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||||| | |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3894541 |
tatcccgtgagcttagttcagttggtatggatattgcatattatatgcaggagc |
3894594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 8125641 - 8125686
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8125641 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
8125686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 19996522 - 19996473
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19996522 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
19996473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 28689742 - 28689693
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28689742 |
cccgtgaacttagctcagttggtagggatattgcatattatatgcaggag |
28689693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 30779635 - 30779590
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30779635 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
30779590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 31529028 - 31528979
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31529028 |
cccgtgagcttagctcagttggtagggatattgaatattatatgcaggag |
31528979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 36625237 - 36625192
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36625237 |
tgagcttagctcagttggtagggatattgcatattatatgcaggag |
36625192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 172 - 216
Target Start/End: Complemental strand, 4640544 - 4640500
Alignment:
| Q |
172 |
agcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4640544 |
agcttagctcagttggtagggatattgcatattatatgcaggagc |
4640500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 26942752 - 26942800
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26942752 |
tcccgtaagcttagctcagttggtagggatattgcatattatatgcagg |
26942800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 39719934 - 39719982
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39719934 |
tcccgtgagtttagctcagttggtagggatattgcatattatatgcagg |
39719982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 3748672 - 3748625
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3748672 |
cccgtgagcttagctcagttggtagggatattgtatattatatgcagg |
3748625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 25939000 - 25938953
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25939000 |
cccgtgagtttagctcagttggtagggatattgcatattatatgcagg |
25938953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 31586951 - 31586994
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31586951 |
tgagcttagctcagttggtagggatattgcatattatatgcagg |
31586994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 169 - 216
Target Start/End: Complemental strand, 31673316 - 31673269
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31673316 |
gtgagcttgtctcagttggtaaggatattgcatattatatgcaggagc |
31673269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 32256624 - 32256577
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32256624 |
cccgtgagcttagctcagttggtagggatattgcatgttatatgcagg |
32256577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 34102681 - 34102634
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
34102681 |
cccgtgagcttagttcagttggtagggatattgcatattatatgcagg |
34102634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 34898837 - 34898790
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
34898837 |
cccgtgagcttagttcagttggtagggatattgcatattatatgcagg |
34898790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 36763429 - 36763476
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
36763429 |
cccgtgagcttggctcagttggtagggacattgcataatatatgcagg |
36763476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 41936477 - 41936430
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41936477 |
cccgtaagcttagctcagttggtagggatattgcatattatatgcagg |
41936430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 46795999 - 46795952
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46795999 |
cccgtgagcttagctcagttggtagggatattgcattttatatgcagg |
46795952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 169 - 216
Target Start/End: Original strand, 48251575 - 48251622
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48251575 |
gtgagcttagctcagttgatagggatattgcatattatatgcaggagc |
48251622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 48739814 - 48739767
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48739814 |
cccgtgagcttagctcagttggtagggatattgcattttatatgcagg |
48739767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 50536902 - 50536855
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50536902 |
cccgtgagcttagctcagttggtagagatattgcatattatatgcagg |
50536855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 53163594 - 53163637
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53163594 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
53163637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 8964846 - 8964796
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8964846 |
cccgtgagtttagctcagttggtagggatattgcatatcatatgcaggagc |
8964796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 163 - 213
Target Start/End: Complemental strand, 29373522 - 29373472
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29373522 |
tatcccgtgagcttaactcagttggtaaggatattgcatattatatgcagg |
29373472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 30555297 - 30555247
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
30555297 |
cccgtgagcttagctcagttggtagggatattgcatattaaatgcaagagc |
30555247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 31922356 - 31922406
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||| ||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
31922356 |
cccgtgagcttgtctcagttggtaagaatattgcatattatatgcaggagc |
31922406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 32144584 - 32144634
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32144584 |
cccgtgagcttagcttagttggtaggggtattgcatattatatgcaggagc |
32144634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 33225418 - 33225368
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
33225418 |
cccgtgagcttagctcagttggtagggatatcgcattttatatgcaggagc |
33225368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 178 - 216
Target Start/End: Original strand, 49447150 - 49447188
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49447150 |
gctcagttggtagggatattgcatattatatgcaggagc |
49447188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 54769899 - 54769853
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54769899 |
ccgtgagcttagcttagttggtagggatattgcatattatatgcagg |
54769853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 2368938 - 2368983
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2368938 |
cgtgagcttagctcagttgttagggatattgcatattatatgcagg |
2368983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 11250659 - 11250614
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11250659 |
cgtgaacttagctcagttggtagggatattgcatattatatgcagg |
11250614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 11820004 - 11820053
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
11820004 |
cccgtgagcttagctcagttggtagggatattgcatgttatatgtaggag |
11820053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 211
Target Start/End: Original strand, 17218492 - 17218533
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17218492 |
tgagcttagctcagttggtagggatattgcatattatatgca |
17218533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 209
Target Start/End: Complemental strand, 17602744 - 17602703
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17602744 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
17602703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 49408775 - 49408824
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
49408775 |
cccgtgagcttagctcagctggtagggatatcgcatattatatgcaggag |
49408824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 49750474 - 49750429
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49750474 |
cgtgagcttagctcagttgatagggatattgcatattatatgcagg |
49750429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 52309180 - 52309131
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52309180 |
cccgtgagcttaactcagttggtagggatattgcatactatatgcaggag |
52309131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 4541897 - 4541945
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||| |||||||||||||| |
|
|
| T |
4541897 |
tcccgtgagcttagttcagttggtagggatattgtatattatatgcagg |
4541945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 4860160 - 4860208
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
4860160 |
tcccgtgagcttagctcagttggtacggatattgcattttatatgcagg |
4860208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 212
Target Start/End: Original strand, 24430144 - 24430192
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
24430144 |
atcccgtgagcttagctcagttggtagagatattgtatattatatgcag |
24430192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 165 - 209
Target Start/End: Original strand, 48546172 - 48546216
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
48546172 |
tcccgtgagcttagctcagttggtagtgatattgcatattatatg |
48546216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 52670224 - 52670180
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
52670224 |
tcccgtgagcttagttcagttggtagggatattgcatattatatg |
52670180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 54021401 - 54021357
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54021401 |
gtgagcttagctcagttggtatggatattgcatattatatgcagg |
54021357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 212
Target Start/End: Original strand, 4880168 - 4880215
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||| |||||||||| |
|
|
| T |
4880168 |
tcccgtgagcttagctcagttggtacggatattgcattttatatgcag |
4880215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 216
Target Start/End: Complemental strand, 5326107 - 5326056
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||| ||||| |||| |
|
|
| T |
5326107 |
tcccgtgagcttagctcagttggtagcgatattgcatattacatgcatgagc |
5326056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 6488128 - 6488171
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6488128 |
tgagcttagctcaattggtagggatattgcatattatatgcagg |
6488171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 163 - 206
Target Start/End: Complemental strand, 16906910 - 16906867
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattat |
206 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16906910 |
tatcccatgagcttggctcagttgctagggatattgcatattat |
16906867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 17608389 - 17608342
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
17608389 |
cccgtgagcttaacttagttggtagggatattgcatattatatgcagg |
17608342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 20489819 - 20489862
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20489819 |
tgagcttagctcagttggtagggttattgcatattatatgcagg |
20489862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 203
Target Start/End: Original strand, 34757527 - 34757566
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatat |
203 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34757527 |
atcccgtgagcttagctcagttggtagggatattgcatat |
34757566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 34847543 - 34847590
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34847543 |
cccgtgagcttaattcagttggtagggatattgcatattatatgcagg |
34847590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 37488530 - 37488483
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
37488530 |
cccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
37488483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 45871017 - 45871064
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| || ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45871017 |
cccgtgagtttagctcagttggtagggatattgtatattatatgcagg |
45871064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 208
Target Start/End: Complemental strand, 52046456 - 52046413
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
52046456 |
tcccgtgagcttagctcagttggtagggatattgcattttatat |
52046413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 216
Target Start/End: Original strand, 53577958 - 53578005
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
53577958 |
gtgagcttagctcagttggtagggatgttgcatattatatgcaagagc |
53578005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 53752770 - 53752723
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
53752770 |
cccgtgagcttaactcagttggtagggatatggcatattatatgcagg |
53752723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 178 - 216
Target Start/End: Complemental strand, 2390412 - 2390374
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2390412 |
gctcagttgatagggatattgcatattatatgcaggagc |
2390374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 179 - 213
Target Start/End: Complemental strand, 4200642 - 4200608
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4200642 |
ctcagttggtagggatattgcatattatatgcagg |
4200608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 179 - 213
Target Start/End: Original strand, 11436517 - 11436551
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11436517 |
ctcagttggtagggatattgcatattatatgcagg |
11436551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 163 - 209
Target Start/End: Complemental strand, 12894603 - 12894557
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
12894603 |
tatcccgtgagcttaactcagttggtagggatattgcattttatatg |
12894557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 22472384 - 22472334
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
22472384 |
cccgtgagcttaactcagttggtagagatattgcatattatatgcaagagc |
22472334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 33706797 - 33706747
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| ||||||||||||| |||| |
|
|
| T |
33706797 |
cccgtgagcttagctcaattggtagggatattacatattatatgcaagagc |
33706747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 178 - 212
Target Start/End: Complemental strand, 42108240 - 42108206
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42108240 |
gctcagttggtagggatattgcatattatatgcag |
42108206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 212
Target Start/End: Original strand, 44364021 - 44364067
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
44364021 |
cccgtgagtttaactcagttggtagggatattgcatattatatgcag |
44364067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 169 - 211
Target Start/End: Original strand, 52984013 - 52984055
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
52984013 |
gtgagcttagctcagttggtagggatattgcatattgtatgca |
52984055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 179 - 213
Target Start/End: Complemental strand, 53432794 - 53432760
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
53432794 |
ctcagttggtagggatattgcatattatatgcagg |
53432760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 167 - 216
Target Start/End: Original strand, 25833824 - 25833873
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||| ||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25833824 |
ccgttagcttagctcagttggtaaagatattgcatattatatgcaggagc |
25833873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 180 - 213
Target Start/End: Original strand, 42268798 - 42268831
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42268798 |
tcagttggtagggatattgcatattatatgcagg |
42268831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 33607010 - 33606962
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| ||| ||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
33607010 |
tcccgtgaacttagctcaattggtagggatattgcattttatatgcagg |
33606962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 163 - 211
Target Start/End: Original strand, 34740284 - 34740332
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||| |||||| || || ||||||||||||||||||||||||||||||| |
|
|
| T |
34740284 |
tatctcgtgagtttagcccagttggtagggatattgcatattatatgca |
34740332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 212
Target Start/End: Original strand, 46879999 - 46880043
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||| |||||||||| |
|
|
| T |
46879999 |
cgtgagcttagctcagttgatagggatattgcattttatatgcag |
46880043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 51772892 - 51772936
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
51772892 |
gtgagcttaacttagttggtagggatattgcatattatatgcagg |
51772936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 8762150 - 8762103
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| || |||||||||||||||| ||||||||||||||| |
|
|
| T |
8762150 |
cccgtgagcttaacttagttggtagggatattacatattatatgcagg |
8762103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 209
Target Start/End: Complemental strand, 13638315 - 13638272
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||| | |||||||||||||||||| ||||||||||| |
|
|
| T |
13638315 |
cccgtgagcttagttcagttggtagggatattacatattatatg |
13638272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 162 - 209
Target Start/End: Original strand, 25488881 - 25488928
Alignment:
| Q |
162 |
gtatcccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||| ||||||||||| |
|
|
| T |
25488881 |
gtatcccgtgagcttaactcagttgttagggatattacatattatatg |
25488928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 28193802 - 28193845
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28193802 |
tgagcttaactcagttggtagggatattgcattttatatgcagg |
28193845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 28396848 - 28396805
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28396848 |
tgagcttaactcagttggtagggatattgcatgttatatgcagg |
28396805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 209
Target Start/End: Complemental strand, 29559740 - 29559701
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29559740 |
tgagcttaactcagttggtagggatattgcatattatatg |
29559701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 37112814 - 37112857
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
37112814 |
tgagcttagctcagttggtaaggatattgcattttatatgcagg |
37112857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 209
Target Start/End: Complemental strand, 45551879 - 45551836
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| ||||||| |
|
|
| T |
45551879 |
cccgtgagcttagctcagttggtagggatatcgcattttatatg |
45551836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 180 - 215
Target Start/End: Complemental strand, 51152683 - 51152648
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51152683 |
tcagttggtagggatgttgcatattatatgcaggag |
51152648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 52575463 - 52575510
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
52575463 |
cccgtgagcttagctcagttggtacgaatattgcattttatatgcagg |
52575510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 211
Target Start/End: Original strand, 552174 - 552216
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
552174 |
gtgagcttaactcagttggtagggatattgcataatatatgca |
552216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 11234442 - 11234492
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||| |||| ||||||| || |||||||||||||| |
|
|
| T |
11234442 |
cccgtgagcttagctcagttagtagagatattgtattttatatgcaggagc |
11234492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 20887838 - 20887792
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||| | |||||||| |
|
|
| T |
20887838 |
ccgtgagtttagctcagttggtagggatattgcataatttatgcagg |
20887792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 213
Target Start/End: Complemental strand, 25954867 - 25954817
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| || ||||| |||||| |||||| |||||||||||||||| |
|
|
| T |
25954867 |
tatcccgtgaggttagctcaattggtatggatatcgcatattatatgcagg |
25954817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 208
Target Start/End: Original strand, 31316634 - 31316676
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| ||||||||| |
|
|
| T |
31316634 |
cccgtgagcttagctcagttgatagggatattgtatattatat |
31316676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 39300384 - 39300433
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
39300384 |
cccgtgagcttagctcagttggtagggatattacattttata-gcaggagc |
39300433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 213
Target Start/End: Original strand, 44106615 - 44106649
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
44106615 |
ctcagttgctagggatattgcatattatatgcagg |
44106649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 208
Target Start/End: Complemental strand, 44685238 - 44685196
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
||||||||||| ||| ||||||||| ||||||||||||||||| |
|
|
| T |
44685238 |
cccgtgagcttagcttagttggtagagatattgcatattatat |
44685196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 209
Target Start/End: Original strand, 45198724 - 45198766
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||| ||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
45198724 |
ccgttagcttagttcagttggtagggatattgcatattatatg |
45198766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 213
Target Start/End: Complemental strand, 50675799 - 50675765
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
50675799 |
ctcagttggtagggatattgcatattatatacagg |
50675765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 2007153 - 2007104
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||| ||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2007153 |
cccgtgaacttaactcagttggtagaaatattgcatattatatgcaggag |
2007104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 8756526 - 8756571
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
8756526 |
cgtgagcttaactcagttggtaggaatattgcattttatatgcagg |
8756571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 203
Target Start/End: Original strand, 10349405 - 10349442
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatat |
203 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
10349405 |
cccgtgagcttagctcagttgatagggatattgcatat |
10349442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 167 - 212
Target Start/End: Original strand, 15299073 - 15299118
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||| || | ||||||||||||||||||| ||||||||||||| |
|
|
| T |
15299073 |
ccgtgagtttagttcagttggtagggatattgtatattatatgcag |
15299118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 179 - 212
Target Start/End: Original strand, 22857407 - 22857440
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
22857407 |
ctcagttggtaggaatattgcatattatatgcag |
22857440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 209
Target Start/End: Complemental strand, 25279127 - 25279086
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||| ||| ||||||||||||||||| |||||||||| |
|
|
| T |
25279127 |
cgtgagcttagcttagttggtagggatattgtatattatatg |
25279086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 179 - 208
Target Start/End: Complemental strand, 29496163 - 29496134
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29496163 |
ctcagttggtagggatattgcatattatat |
29496134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 44764724 - 44764769
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||| | |||||||| |
|
|
| T |
44764724 |
cgtgagcttagctcagttggtagggacattgcataatttatgcagg |
44764769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 167 - 212
Target Start/End: Complemental strand, 44945730 - 44945685
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| |||||||||||| |
|
|
| T |
44945730 |
ccgtgagcttatctcagttggtaggaatattgcgtattatatgcag |
44945685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 45513065 - 45513016
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||| ||||| |||||||| ||| |||||||||||||||||| |||||| |
|
|
| T |
45513065 |
cccgtaagcttagctcagttagtatggatattgcatattatatacaggag |
45513016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 167 - 212
Target Start/End: Complemental strand, 46730842 - 46730797
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||||||| ||||||||| |||| |||| ||||||||||||||| |
|
|
| T |
46730842 |
ccgtgagcttagctcagttgataggcatatagcatattatatgcag |
46730797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 49728695 - 49728748
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||| ||||||| |||| |||||||||||||||||| ||||||||| |||| |
|
|
| T |
49728695 |
tatcccctgagcttaactcaattggtagggatattgcattttatatgcaagagc |
49728748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 184 - 213
Target Start/End: Complemental strand, 54349892 - 54349863
Alignment:
| Q |
184 |
ttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
54349892 |
ttggtagggatattgcatattatatgcagg |
54349863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 16886585 - 16886629
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||| ||| |||| |
|
|
| T |
16886585 |
gtgagcttagctcagttggtagggacattgcatattgtatacagg |
16886629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 212
Target Start/End: Original strand, 17765579 - 17765623
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||| || | |||||||||||||||| ||||||||||||| |
|
|
| T |
17765579 |
cgtgagcttagcccggttggtagggatattgtatattatatgcag |
17765623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 212
Target Start/End: Original strand, 19066899 - 19066943
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||| || | |||||||||||||||| ||||||||||||| |
|
|
| T |
19066899 |
cgtgagcttagcccggttggtagggatattgtatattatatgcag |
19066943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 27983858 - 27983902
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
27983858 |
gtgagcttagctcagttggtagaaatattgcattttatatgcagg |
27983902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 32776214 - 32776258
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| | |||||||| |
|
|
| T |
32776214 |
gtgagcttagctcagttggtagggacattgcataatttatgcagg |
32776258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 36834772 - 36834728
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| |||||| || ||||||||||| |||||||||||||| |
|
|
| T |
36834772 |
gtgagcttagctcagctgatagggatattgtatattatatgcagg |
36834728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 210
Target Start/End: Complemental strand, 40723730 - 40723686
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgc |
210 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
40723730 |
cccgagagcttaactcagttggtagggatattgcatgttatatgc |
40723686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 213
Target Start/End: Complemental strand, 40910246 - 40910203
Alignment:
| Q |
172 |
agcttggctcagttggtaggg--atattgcatattatatgcagg |
213 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40910246 |
agcttagctcagttggtagggggatattgcatattatatgcagg |
40910203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 208
Target Start/End: Complemental strand, 52434723 - 52434695
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52434723 |
tcagttggtagggatattgcatattatat |
52434695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 90 - 40
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
90 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
40 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 8966 - 9016
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8966 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
9016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 17620 - 17670
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17620 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
17670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 59783 - 59833
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
59783 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
59833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 167 - 216
Target Start/End: Original strand, 83626 - 83675
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||| || |||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
83626 |
ccgtgagtttagctcagttatttgggatattgcatattatatgcaggagc |
83675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 266767 - 266717
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
266767 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
266717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 5e-18; HSPs: 159)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 94581 - 94531
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
94581 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
94531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 10736944 - 10736894
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10736944 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
10736894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 11875886 - 11875936
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11875886 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
11875936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 11890893 - 11890943
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11890893 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
11890943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 17698522 - 17698572
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17698522 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
17698572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 29716860 - 29716910
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29716860 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
29716910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 165 - 215
Target Start/End: Complemental strand, 34158728 - 34158678
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34158728 |
tcccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
34158678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 34413062 - 34413112
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34413062 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
34413112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 1937310 - 1937359
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1937310 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
1937359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 167 - 216
Target Start/End: Complemental strand, 2787150 - 2787101
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2787150 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
2787101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 12295 - 12248
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12295 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
12248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 8265268 - 8265315
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8265268 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
8265315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 16449125 - 16449172
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16449125 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
16449172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 23178961 - 23178914
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23178961 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
23178914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 26022247 - 26022294
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26022247 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
26022294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 32719677 - 32719630
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32719677 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
32719630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 35939487 - 35939534
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35939487 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
35939534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 41689882 - 41689929
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41689882 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
41689929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 169 - 216
Target Start/End: Original strand, 42006781 - 42006828
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42006781 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
42006828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 6280480 - 6280530
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6280480 |
cccgtgagcttagctcagttggtagggatattgaatattatatgcaggagc |
6280530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 6659289 - 6659339
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6659289 |
cccgtgagattagctcagttggtagggatattgcatattatatgcaggagc |
6659339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 6739691 - 6739741
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6739691 |
cccgtgagattagctcagttggtagggatattgcatattatatgcaggagc |
6739741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 14876672 - 14876622
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14876672 |
cccgtgagcttagctcagttggtagggaaattgcatattatatgcaggagc |
14876622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 17027950 - 17027900
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17027950 |
cccgtgagcttagctcagttggtagggatattgcatattatatgccggagc |
17027900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 17558386 - 17558336
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17558386 |
cccgtgagcttagctcagttggtagggatattgcatattatatgccggagc |
17558336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 23858198 - 23858244
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23858198 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
23858244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 28909465 - 28909515
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28909465 |
cccgtgagcttagctcagttggtagggatattgcatattacatgcaggagc |
28909515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 29514626 - 29514676
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29514626 |
cccgtgagcttagctcagttggtagggatattgtatattatatgcaggagc |
29514676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 30972887 - 30972837
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30972887 |
cccgtgagcttagctcagttggtagggatattgcatattatatgccggagc |
30972837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 34472296 - 34472346
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34472296 |
tcccgtgagcttaactcagttggtagggatattgcatattatatgcaggag |
34472346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 37717363 - 37717413
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37717363 |
cccgtgagcttaactcagttggtagggatattgcatattatatgcaggagc |
37717413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 212
Target Start/End: Original strand, 39362265 - 39362311
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39362265 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcag |
39362311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 43284036 - 43283986
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43284036 |
cccgtgagtttagctcagttggtagggatattgcatattatatgcaggagc |
43283986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 133415 - 133464
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
133415 |
cccgtgagcttagctcagttgatagggatattgcatattatatgcaggag |
133464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 163 - 216
Target Start/End: Original strand, 7194259 - 7194312
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||| ||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7194259 |
tatcccttgagcttagttcagttggtagggatattgcatattatatgcaggagc |
7194312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 167 - 216
Target Start/End: Original strand, 13406601 - 13406650
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13406601 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcaggagc |
13406650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 167 - 216
Target Start/End: Complemental strand, 16432197 - 16432148
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16432197 |
ccgtgaacttagctcagttggtagggatattgcatattatatgcaggagc |
16432148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 26567318 - 26567269
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26567318 |
cccgtgagcttagctcagttgatagggatattgcatattatatgcaggag |
26567269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 167 - 216
Target Start/End: Complemental strand, 31451026 - 31450977
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31451026 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcaggagc |
31450977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 34266012 - 34266061
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34266012 |
cccgcgagcttagctcagttggtagggatattgcatattatatgcaggag |
34266061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 38219638 - 38219589
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38219638 |
cccgtgagcatagctcagttggtagggatattgcatattatatgcaggag |
38219589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 168 - 216
Target Start/End: Complemental strand, 10200749 - 10200701
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10200749 |
cgtgagcttagctcagttggtagagatattgcatattatatgcaggagc |
10200701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 27077164 - 27077120
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27077164 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
27077120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 168 - 216
Target Start/End: Original strand, 38344051 - 38344099
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38344051 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagc |
38344099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 40362047 - 40362095
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40362047 |
tcccgtgagcttagctcagttagtagggatattgcatattatatgcagg |
40362095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 168 - 216
Target Start/End: Original strand, 43186855 - 43186903
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43186855 |
cgtgagtttagctcagttggtagggatattgcatattatatgcaggagc |
43186903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 2792779 - 2792826
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2792779 |
cccgtgagcttagctcagttgatagggatattgcatattatatgcagg |
2792826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 165 - 216
Target Start/End: Original strand, 7765642 - 7765693
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
7765642 |
tcccgtgagcttagctcagttggtatggatattacatattatatgcaggagc |
7765693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 8034482 - 8034435
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8034482 |
cccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
8034435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 20540176 - 20540129
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20540176 |
cccgtgagcttagctcagttgttagggatattgcatattatatgcagg |
20540129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 165 - 216
Target Start/End: Complemental strand, 22274682 - 22274631
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||| |||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22274682 |
tcccatgagtttagctcagttggtagggatattgcatattatatgcaggagc |
22274631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 169 - 216
Target Start/End: Complemental strand, 23435300 - 23435253
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23435300 |
gtgagcttagctcagttgatagggatattgcatattatatgcaggagc |
23435253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 33617972 - 33618019
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33617972 |
cccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
33618019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 34894369 - 34894416
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34894369 |
cccgtaagcttagctcagttggtagggatattgcatattatatgcagg |
34894416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 169 - 216
Target Start/End: Complemental strand, 38620408 - 38620361
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38620408 |
gtgagcttagctcagttggtagggatattgtatattatatgcaggagc |
38620361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 43656036 - 43656079
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43656036 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
43656079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 4615746 - 4615696
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| || | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4615746 |
cccgtgagtttagttcagttggtagggatattgcatattatatgcaggagc |
4615696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 163 - 213
Target Start/End: Original strand, 5570891 - 5570941
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
5570891 |
tatcccgtgagcttagctcagttggttgggatattgcatgttatatgcagg |
5570941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 7797130 - 7797180
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7797130 |
cccgtaagcttagctcagttggtagggatattgaatattatatgcaggagc |
7797180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 7816403 - 7816453
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7816403 |
cccgtaagcttagctcagttggtagggatattgaatattatatgcaggagc |
7816453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 10083164 - 10083210
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10083164 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
10083210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 10587348 - 10587302
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10587348 |
tcccgtaagcttagctcagttggtagggatattgcatattatatgca |
10587302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 24296937 - 24296891
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24296937 |
ccgtgagcttagctcagttagtagggatattgcatattatatgcagg |
24296891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 163 - 213
Target Start/End: Original strand, 41458292 - 41458342
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41458292 |
tatctcgtgagcttaactcagttggtagggatattgcatattatatgcagg |
41458342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 42880948 - 42880998
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42880948 |
cccgtgagcttaactcagttggtagggatattgcatattatatgtaggagc |
42880998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 172 - 213
Target Start/End: Complemental strand, 5328631 - 5328590
Alignment:
| Q |
172 |
agcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5328631 |
agcttagctcagttggtagggatattgcatattatatgcagg |
5328590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 209
Target Start/End: Complemental strand, 8698648 - 8698607
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8698648 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
8698607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 10573103 - 10573148
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10573103 |
cgtgagtttagctcagttggtagggatattgcatattatatgcagg |
10573148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 207
Target Start/End: Complemental strand, 44340415 - 44340374
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattata |
207 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44340415 |
cccgtgagcttagctcagttggtagggatattgcatattata |
44340374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 8862193 - 8862149
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8862193 |
gtgagcttagctaagttggtagggatattgcatattatatgcagg |
8862149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 12273752 - 12273700
Alignment:
| Q |
161 |
agtatcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||| |||||||| ||||| |||||||||||||||| |||| |
|
|
| T |
12273752 |
agtatcccgtgagcttagctcagttagtaggaatattgcatattatatacagg |
12273700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 168 - 212
Target Start/End: Complemental strand, 26192784 - 26192740
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
26192784 |
cgtgagcttagttcagttggtagggatattgcatattatatgcag |
26192740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 168 - 216
Target Start/End: Complemental strand, 28420492 - 28420444
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
28420492 |
cgtgagcttagctcagttggtaggaatattgcatattatatgctggagc |
28420444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 167 - 215
Target Start/End: Complemental strand, 43053954 - 43053906
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43053954 |
ccgtgagcttaactcagttggtagggatatttcatattatatgcaggag |
43053906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 257539 - 257586
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
257539 |
cccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
257586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 658381 - 658334
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
658381 |
cccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
658334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 844117 - 844070
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
844117 |
cccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
844070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 178 - 213
Target Start/End: Complemental strand, 3190007 - 3189972
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3190007 |
gctcagttggtagggatattgcatattatatgcagg |
3189972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 216
Target Start/End: Original strand, 5038573 - 5038608
Alignment:
| Q |
181 |
cagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
5038573 |
cagttggtagggatattgcatattatatgcaggagc |
5038608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 7388455 - 7388502
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7388455 |
cccgtgaacttaactcagttggtagggatattgcatattatatgcagg |
7388502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 8953937 - 8953890
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8953937 |
cgtgagcttaacacagttggtagggatattgcatattatatgcaggag |
8953890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 216
Target Start/End: Original strand, 8969098 - 8969145
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| ||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
8969098 |
gtgagcttagctaagttggtaggaatattgcatattatatgcaggagc |
8969145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 10568085 - 10568132
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10568085 |
cccgtgagtttagctcagttggtagggatattgcatattaaatgcagg |
10568132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 216
Target Start/End: Original strand, 11483119 - 11483170
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||| | |||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
11483119 |
tcccgtgagcgtagctcagttagtaggaatattgcatattatatgcaggagc |
11483170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 17072633 - 17072586
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| || ||||||||||| ||||||||||||||||||||| |
|
|
| T |
17072633 |
cccgtgagcttagcacagttggtaggtatattgcatattatatgcagg |
17072586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 17575638 - 17575685
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| || ||||||||||| ||||||||||||||||||||| |
|
|
| T |
17575638 |
cccgtgagcttagcacagttggtaggtatattgcatattatatgcagg |
17575685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 24458317 - 24458364
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| |||||||||||||| |
|
|
| T |
24458317 |
cccgtgagcttagctcagttggaagggatattgtatattatatgcagg |
24458364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 29260621 - 29260668
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29260621 |
cgtgagcttaactcagctggtagggatattgcatattatatgcaggag |
29260668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 32258004 - 32258051
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatgc |
210 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||| ||||| |
|
|
| T |
32258004 |
tatcccgtgagattagctcagttggtagggatattgcatattctatgc |
32258051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 36540287 - 36540334
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36540287 |
cccgtgagcttaactcagttggtagggatattgcattttatatgcagg |
36540334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 38402251 - 38402298
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
38402251 |
cccgtgagcttaactcagttggtagggatattgcatattatttgcagg |
38402298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 38955264 - 38955217
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38955264 |
cccgtgagcttaactcagttggtagggatattacatattatatgcagg |
38955217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 43856452 - 43856405
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43856452 |
cccgtgagcttaactcagttggtagggatattgcattttatatgcagg |
43856405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 1632507 - 1632461
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
1632507 |
gtgagcttagctcagttggtaggaatattacatattatatgcaggag |
1632461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 4654181 - 4654135
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||| ||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
4654181 |
tcccttgagcttagctcagttgctagggatattgcatattatatgca |
4654135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 212
Target Start/End: Complemental strand, 5326240 - 5326194
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||| |||||||||| |
|
|
| T |
5326240 |
cccgtgagcttagctcagttggtagagatattgcattttatatgcag |
5326194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 7764004 - 7763962
Alignment:
| Q |
171 |
gagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7764004 |
gagcttagctcagttggtagagatattgcatattatatgcagg |
7763962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 10594286 - 10594236
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| | | |||||||||||||||||||| |||||||||||||| |
|
|
| T |
10594286 |
cccgtgagcttagtttagttggtagggatattgcattttatatgcaggagc |
10594236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 18452355 - 18452305
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||| |||| |||||||||||||||| ||||||| |
|
|
| T |
18452355 |
cccgtgagcttagctcagttgttaggaatattgcatattatatacaggagc |
18452305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 26280854 - 26280804
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
26280854 |
cccgtgagcttaactcagttggtagggatattgcattttatatgccggagc |
26280804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 38745349 - 38745311
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatatt |
204 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38745349 |
cccgtgagcttagctcagttggtagggatattgcatatt |
38745311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 43980382 - 43980336
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| | ||||||| |||||||||||||||||||||||||| |
|
|
| T |
43980382 |
ccgtgagcttagttcagttgttagggatattgcatattatatgcagg |
43980336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 179 - 213
Target Start/End: Original strand, 44444557 - 44444591
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44444557 |
ctcagttggtagggatattgcatattatatgcagg |
44444591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 178 - 215
Target Start/End: Complemental strand, 13647515 - 13647478
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13647515 |
gctcagttggtagagatattgcatattatatgcaggag |
13647478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 178 - 215
Target Start/End: Complemental strand, 13747940 - 13747903
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13747940 |
gctcagttggtagagatattgcatattatatgcaggag |
13747903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 22437858 - 22437813
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| | |||||||| |
|
|
| T |
22437858 |
cgtgagcttagctcagttggtagggatattgcataatttatgcagg |
22437813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 28628665 - 28628710
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| ||||||||||||| |
|
|
| T |
28628665 |
cccgtgagcttagctcagttggtacggatattacatattatatgca |
28628710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 164 - 209
Target Start/End: Original strand, 33838322 - 33838367
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||| |||||||| |
|
|
| T |
33838322 |
atcccgtgagtttagctcagttggtagggatattgcaaattatatg |
33838367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 37090683 - 37090634
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||| || |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37090683 |
cccgtgagtttaactcagttggtagggatattgtatattatatgcaggag |
37090634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 37290920 - 37290969
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||| || ||||| |||||||||||||||||||||||||| |
|
|
| T |
37290920 |
atcccgtgagcttaacttagttgatagggatattgcatattatatgcagg |
37290969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 212
Target Start/End: Complemental strand, 37524272 - 37524231
Alignment:
| Q |
171 |
gagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37524272 |
gagcttagctcagttggtagagatattgcatattatatgcag |
37524231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 209
Target Start/End: Complemental strand, 197131 - 197091
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
197131 |
gtgagcttagctcagttggtagggatattgcatataatatg |
197091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 209
Target Start/End: Complemental strand, 311968 - 311928
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
311968 |
gtgagcttagctcagttggtagggatattgcatataatatg |
311928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 213
Target Start/End: Complemental strand, 7109353 - 7109313
Alignment:
| Q |
173 |
gcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7109353 |
gcttagctcagttggtagagatattgcatattatatgcagg |
7109313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 210
Target Start/End: Complemental strand, 9187293 - 9187249
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgc |
210 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| |||||||| |
|
|
| T |
9187293 |
cccgtgagcttagctcagttggtagggatattacattttatatgc |
9187249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 10030415 - 10030459
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| || ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10030415 |
gtgagtttagctcagttggtagagatattgcatattatatgcagg |
10030459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 11297064 - 11297020
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||| ||||||| |
|
|
| T |
11297064 |
tcccgtgagcttagttcagttggtagggatattgcattttatatg |
11297020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 22487876 - 22487920
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||| || |||||||||||||||||||||||| ||||||||| |
|
|
| T |
22487876 |
ccgtgagtttagctcagttggtagggatattgcattttatatgca |
22487920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 208
Target Start/End: Original strand, 28460203 - 28460243
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28460203 |
cgtgagcttaactcagttggtagggatattgcatattatat |
28460243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 210
Target Start/End: Original strand, 37092091 - 37092135
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgc |
210 |
Q |
| |
|
|||||||| || ||||||||||||||||||||| ||||||||||| |
|
|
| T |
37092091 |
cccgtgagtttagctcagttggtagggatattgtatattatatgc |
37092135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 40094884 - 40094932
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| ||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
40094884 |
tcccgtgagcttagctcagttgataaggatattgcattttatatgcagg |
40094932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 44673719 - 44673671
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
44673719 |
tcccgtgagcttagctcagttggtagggatatcacattttatatgcagg |
44673671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 481011 - 481058
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| | |||||||| |
|
|
| T |
481011 |
cccgtgagcttagctcagttggtagggacattgcataatttatgcagg |
481058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 2168517 - 2168470
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| |||||| |||| |
|
|
| T |
2168517 |
cccgtgagcttagctcagttggtagggatattacattttatatacagg |
2168470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 2590149 - 2590192
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||| ||||| || ||||||||||||||||||||||| |
|
|
| T |
2590149 |
cccgtgagcttagctcaattagtagggatattgcatattatatg |
2590192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 208
Target Start/End: Complemental strand, 3949148 - 3949109
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3949148 |
gtgagcttaactcagttggtagggatattgcatattatat |
3949109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 212
Target Start/End: Complemental strand, 8402407 - 8402360
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||||||||| ||||| |||||||||| |||||||| ||||||||| |
|
|
| T |
8402407 |
tcccgtgagcttagctcaattggtagggacattgcataatatatgcag |
8402360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 26734072 - 26734119
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| ||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26734072 |
cccgtaagcttagctcagttggtagatatattgcatattatatgcagg |
26734119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 29729118 - 29729165
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| || | ||||||||||||||||||||||||||||| |||| |
|
|
| T |
29729118 |
cccgtgagtttagttcagttggtagggatattgcatattatatacagg |
29729165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 33604242 - 33604196
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
33604242 |
cccgtgagcttagctcagttggtagggatattg-atattacatgcagg |
33604196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 169 - 212
Target Start/End: Complemental strand, 37535566 - 37535523
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||| || ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37535566 |
gtgagtttagctcaattggtagggatattgcatattatatgcag |
37535523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 39587547 - 39587594
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||| |||||| |||| |
|
|
| T |
39587547 |
cccgtgagcttagctcagttggtagagatattgcattttatattcagg |
39587594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 209
Target Start/End: Complemental strand, 40322933 - 40322890
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
40322933 |
cccgtgagcttggctcagttggtagaaatattgcattttatatg |
40322890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 40740525 - 40740572
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
40740525 |
cccgtaagcttaactcagttgatagggatattgcatattatatgcagg |
40740572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 41616436 - 41616389
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| | |||||||||||||||||||| |||||||||||||| |
|
|
| T |
41616436 |
cccgtgagcataactcagttggtagggatattgtatattatatgcagg |
41616389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 207
Target Start/End: Original strand, 42457131 - 42457174
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattata |
207 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
42457131 |
atcccgtgagtttatctcagttggtagggatattgcatattata |
42457174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 216
Target Start/End: Original strand, 1503914 - 1503959
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||| |||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
1503914 |
tgagcttagctcagttggcagggatattg-atattatatgcaggagc |
1503959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 215
Target Start/End: Original strand, 5332919 - 5332965
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||| ||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
5332919 |
gtgagcttagctcagttggtagagatattatatattatatgcaggag |
5332965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 213
Target Start/End: Original strand, 9370185 - 9370215
Alignment:
| Q |
183 |
gttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9370185 |
gttggtagggatattgcatattatatgcagg |
9370215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 214
Target Start/End: Original strand, 11127905 - 11127951
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagga |
214 |
Q |
| |
|
||||| ||| |||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
11127905 |
cgtgaacttagctcagttggtaggaatattgcatattatatacagga |
11127951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 216
Target Start/End: Complemental strand, 13773450 - 13773412
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
13773450 |
gctcagttggtagagatattgcatattatatgtaggagc |
13773412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 211
Target Start/End: Original strand, 18942918 - 18942960
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||| |||||||| |
|
|
| T |
18942918 |
gtgagcttagctcagttggtagggataatgcataatatatgca |
18942960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 19161964 - 19161919
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||| ||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19161964 |
ccgtaagcttagctcagttggtagg-atattgcatattatatgcagg |
19161919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 37838578 - 37838624
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||| ||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37838578 |
ccgtaagcttagctcaaatggtagggatattgcatattatatgcagg |
37838624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 179 - 212
Target Start/End: Complemental strand, 1286609 - 1286576
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
1286609 |
ctcaattggtagggatattgcatattatatgcag |
1286576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 172 - 213
Target Start/End: Original strand, 5683760 - 5683801
Alignment:
| Q |
172 |
agcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
5683760 |
agcttagctcaattggtaggaatattgcatattatatgcagg |
5683801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 164 - 209
Target Start/End: Complemental strand, 23339968 - 23339923
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| |||||||||| |
|
|
| T |
23339968 |
atcccgtgagcttaactcagttggtagagatattgtatattatatg |
23339923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 26796960 - 26797005
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||| || |||||||||||||||| |||||||||| |||||||| |
|
|
| T |
26796960 |
cgtgagtttagctcagttggtagggacattgcatattttatgcagg |
26797005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 29734075 - 29734026
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||| || ||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
29734075 |
cccgtgagtttaactcagttggtaaggatattgtatattatatgcaggag |
29734026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 180 - 209
Target Start/End: Complemental strand, 38337083 - 38337054
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38337083 |
tcagttggtagggatattgcatattatatg |
38337054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 39974840 - 39974877
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcata |
202 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
39974840 |
tcccgtgagcttagctcagttggtaggaatattgcata |
39974877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 212
Target Start/End: Original strand, 6782901 - 6782933
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
6782901 |
tcagttggtagggatattgcattttatatgcag |
6782933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 216
Target Start/End: Complemental strand, 17499158 - 17499110
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||| ||| ||||||||||||||| |||||||| | ||||||||||| |
|
|
| T |
17499158 |
cgtgagtttgactcagttggtagggacattgcataatttatgcaggagc |
17499110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 211
Target Start/End: Original strand, 19163876 - 19163908
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
19163876 |
ctcagttggtagggatattgcatataatatgca |
19163908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 20164275 - 20164231
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
20164275 |
gtgagcttaactcagttggtagagatattacatattatatgcagg |
20164231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 210
Target Start/End: Complemental strand, 21548552 - 21548524
Alignment:
| Q |
182 |
agttggtagggatattgcatattatatgc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21548552 |
agttggtagggatattgcatattatatgc |
21548524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 22202714 - 22202762
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| | |||||||||| |
|
|
| T |
22202714 |
ccgtgagcttaactcagttggtagggacattgcataatttatgcaggag |
22202762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 209
Target Start/End: Original strand, 29499577 - 29499621
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||| ||||||| |
|
|
| T |
29499577 |
tcccgtgaactcagctcagttggtagggatattgcatgttatatg |
29499621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 41865149 - 41865105
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| ||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
41865149 |
gtgagcttagctcagttggtggagatattacatattatatgcagg |
41865105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 5e-18; HSPs: 101)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 7207844 - 7207894
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7207844 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
7207894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 163 - 213
Target Start/End: Original strand, 8439672 - 8439722
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8439672 |
tatcccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
8439722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 10934599 - 10934649
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10934599 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
10934649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 17441909 - 17441859
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17441909 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
17441859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 19953898 - 19953848
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19953898 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
19953848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 33573817 - 33573867
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33573817 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
33573867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 3794243 - 3794194
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3794243 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
3794194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 9246452 - 9246403
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9246452 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
9246403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 4408358 - 4408405
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4408358 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
4408405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 168 - 211
Target Start/End: Original strand, 7414331 - 7414374
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7414331 |
cgtgagcttggctcagttggtagggatattgcatattatatgca |
7414374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 7545329 - 7545376
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7545329 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
7545376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 7865425 - 7865378
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7865425 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
7865378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 9372271 - 9372224
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9372271 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
9372224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 9435626 - 9435673
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9435626 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
9435673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 15091448 - 15091495
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15091448 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
15091495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 165 - 216
Target Start/End: Complemental strand, 32611625 - 32611574
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32611625 |
tcccatgagcttagctcagttggtagggatattgcatattatatgcaggagc |
32611574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 3294765 - 3294811
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3294765 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
3294811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 9704417 - 9704467
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9704417 |
cccgtgaacttagctcagttggtagggatattgcatattatatgcaggagc |
9704467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 31802053 - 31802103
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31802053 |
cccgtgagcttaactcagttggtagggatattgcatattatatgcaggagc |
31802103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 4869770 - 4869721
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4869770 |
atcccgtgagcttagctcagttggtagggatactgcatattatatgcagg |
4869721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 166 - 210
Target Start/End: Original strand, 607187 - 607231
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgc |
210 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
607187 |
cccgtgagcttagctcagttggtagggatattgcatattatatgc |
607231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 168 - 216
Target Start/End: Original strand, 743565 - 743613
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
743565 |
cgtgagcttagctcagttggtagggatattgcatattagatgcaggagc |
743613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 28030867 - 28030911
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28030867 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
28030911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 168 - 216
Target Start/End: Complemental strand, 28237320 - 28237272
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28237320 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagc |
28237272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 32166368 - 32166416
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32166368 |
tcccgtgagcttagctcaattggtagggatattgcatattatatgcagg |
32166416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 169 - 216
Target Start/End: Original strand, 361166 - 361213
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
361166 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggagc |
361213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 1968996 - 1969043
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1968996 |
cccgtgagcttagctcagttggtagggatattacatattatatgcagg |
1969043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 2251838 - 2251885
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2251838 |
cccgtgagcttagctcagttggtagggatattgcatactatatgcagg |
2251885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 4661096 - 4661143
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4661096 |
cccgtgagcttagcttagttggtagggatattgcatattatatgcagg |
4661143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 6210054 - 6210101
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6210054 |
cccgtgaacttagctcagttggtagggatattgcatattatatgcagg |
6210101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 8857090 - 8857137
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8857090 |
cccgtgagcttagctcagttggtagggatattacatattatatgcagg |
8857137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 27094877 - 27094830
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27094877 |
cccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
27094830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 30885640 - 30885593
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30885640 |
cccgtgagcttagctcagttggtagggatattgcatattatatacagg |
30885593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 165 - 216
Target Start/End: Complemental strand, 32050036 - 32049985
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32050036 |
tcccgtgagcttaactcagctggtagggatattgcatattatatgcaggagc |
32049985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 165 - 212
Target Start/End: Complemental strand, 34432868 - 34432821
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
34432868 |
tcccgtgagcttagttcagttggtagggatattgcatattatatgcag |
34432821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 178 - 216
Target Start/End: Complemental strand, 28148791 - 28148753
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28148791 |
gctcagttggtagggatattgcatattatatgcaggagc |
28148753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 13732812 - 13732857
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13732812 |
cccgtgagcttaactcagttggtagggatattgcatattatatgca |
13732857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 15964015 - 15963966
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15964015 |
atcccctgagcttagctcagttggtagggatattgcatattttatgcagg |
15963966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 17454815 - 17454766
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17454815 |
cccgtgagcttatctcagttggtagagatattgcatattatatgcaggag |
17454766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 3299042 - 3298990
Alignment:
| Q |
161 |
agtatcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||| | ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
3299042 |
agtatcccgtgagcttagatcaattggtagggatattgcatataatatgcagg |
3298990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 31935102 - 31935146
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31935102 |
gtgagcttagctcagttggtagggatattgcattttatatgcagg |
31935146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 978204 - 978157
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
978204 |
cccgtgagtttagctcagttagtagggatattgcatattatatgcagg |
978157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 208
Target Start/End: Original strand, 3196618 - 3196661
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
3196618 |
tcccgtgagcttagctcagttggtagggatattacatattatat |
3196661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 211
Target Start/End: Original strand, 3640516 - 3640559
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
3640516 |
cgtgagcttagctcagttggtagggatattgcatagtatatgca |
3640559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 178 - 213
Target Start/End: Complemental strand, 3795832 - 3795797
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3795832 |
gctcagttggtagggatattgcatattatatgcagg |
3795797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 7177295 - 7177342
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| || ||||||||||| |
|
|
| T |
7177295 |
cccgtgagcttagctcagttggtagggatattgtattttatatgcagg |
7177342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 10483606 - 10483559
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10483606 |
cccgtgatcttagctcagttggtagggatattgcattttatatgcagg |
10483559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 178 - 213
Target Start/End: Complemental strand, 10501197 - 10501162
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
10501197 |
gctcagttggtagggatattgcatattatatgcagg |
10501162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 10517199 - 10517246
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
10517199 |
cccgtgagcttagctcagttggtatggatattgcattttatatgcagg |
10517246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 19374910 - 19374863
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
19374910 |
cccgtgagcttagctcagttagtaggaatattgcatattatatgcagg |
19374863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 209
Target Start/End: Complemental strand, 19892346 - 19892303
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
19892346 |
cccgtgagcttagttcagttggtagggatattgcatattatatg |
19892303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 22574870 - 22574917
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
22574870 |
cccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
22574917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 216
Target Start/End: Original strand, 27218883 - 27218934
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| ||| ||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
27218883 |
tcccgtgaccttagctcagttgatagggatattgcatattatatgtaggagc |
27218934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 212
Target Start/End: Original strand, 28222862 - 28222909
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28222862 |
tcccgtgaacttaactcagttggtagggatattgcatattatatgcag |
28222909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 29284266 - 29284309
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
29284266 |
cccgtgagtttagctcagttggtagggatattgcatattatatg |
29284309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 32813720 - 32813673
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| | |||||||||| ||||||||||||||||||||||| |
|
|
| T |
32813720 |
cccgtgagcttagttcagttggtacggatattgcatattatatgcagg |
32813673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 492903 - 492949
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
492903 |
ccgtgagcttagctcagttggcaaggatattgcatattatatgcagg |
492949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 1100313 - 1100263
Alignment:
| Q |
162 |
gtatcccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||| |||| |||||||||| |
|
|
| T |
1100313 |
gtatcccgtgaacttagctcagttggtagggatatagcattttatatgcag |
1100263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 10628615 - 10628661
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| || |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10628615 |
ccgtgagtttagctcggttggtagggatattgcatattatatgcagg |
10628661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 12284122 - 12284168
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
12284122 |
ccgtgagcttaactcagttggtagggatattgaatattatatgcagg |
12284168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 209
Target Start/End: Original strand, 22997337 - 22997379
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
22997337 |
ccgtgagcttagctcagttggtagggatattgaatattatatg |
22997379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 209
Target Start/End: Complemental strand, 23791064 - 23791022
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
23791064 |
ccgtgagcttagctcagttggtagggatattgaatattatatg |
23791022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 5052143 - 5052094
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| ||||| ||||||||||||| |||| ||||||||||||| |
|
|
| T |
5052143 |
cccgtgagcttagctcaattggtagggatatcgcattttatatgcaggag |
5052094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 7418280 - 7418325
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
7418280 |
cgtgagcttaactcatttggtagggatattgcatattatatgcagg |
7418325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 178 - 211
Target Start/End: Complemental strand, 16966452 - 16966419
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
16966452 |
gctcagttggtagggatattgcatattatatgca |
16966419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 30700257 - 30700212
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30700257 |
tgagcttaactcagttggtacggatattgcatattatatgcaggag |
30700212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 180 - 213
Target Start/End: Complemental strand, 32412369 - 32412336
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32412369 |
tcagttggtagggatattgcatattatatgcagg |
32412336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 216209 - 216253
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
216209 |
gtgagcttagctcaattggtagggatattgcatgttatatgcagg |
216253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 215
Target Start/End: Original strand, 7072091 - 7072127
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7072091 |
ctcagttggtagggatattacatattatatgcaggag |
7072127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 213
Target Start/End: Complemental strand, 894686 - 894655
Alignment:
| Q |
182 |
agttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
894686 |
agttggtagggatattgcatattatatgcagg |
894655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 2816894 - 2816937
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
2816894 |
tgagcttagctcaattggtagggatattgcatgttatatgcagg |
2816937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 213
Target Start/End: Complemental strand, 4089985 - 4089950
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4089985 |
gctcagtcggtagggatattgcatattatatgcagg |
4089950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 213
Target Start/End: Original strand, 5944442 - 5944473
Alignment:
| Q |
182 |
agttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5944442 |
agttggtagggatattgcatattatatgcagg |
5944473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 6419152 - 6419105
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
6419152 |
cccgtgagtttaactcagttggtagagatattgcatattatatgcagg |
6419105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 7153792 - 7153835
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7153792 |
tgagcttaactcagttggtagggatattgcatgttatatgcagg |
7153835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 7581044 - 7581091
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||| || ||||||||||||||||| ||||||||||| |
|
|
| T |
7581044 |
cccgtgagcttagcttagctggtagggatattgcattttatatgcagg |
7581091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 8297627 - 8297674
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||| ||||||||||| |||||| ||||||||||| |
|
|
| T |
8297627 |
cccgtgagcttagctcaattggtagggatgttgcatgttatatgcagg |
8297674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 20568355 - 20568308
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||| ||| |||||||| |||||||||| |
|
|
| T |
20568355 |
cccgtgagcttagctcagttggtaaggacattgcataatatatgcagg |
20568308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 21203038 - 21203081
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||| ||||| |
|
|
| T |
21203038 |
cccgtgagtttagctcagttggtagggatattgcatatcatatg |
21203081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 21248532 - 21248575
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
21248532 |
cccgtaagcttagctcagttggtagggatattgcattttatatg |
21248575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 29733628 - 29733675
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
29733628 |
cccgtgaacttagctcagttggtacggatattacatattatatgcagg |
29733675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 30704960 - 30705003
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||| ||||||| |
|
|
| T |
30704960 |
cccgtgagcttagttcagttggtagggatattgcatgttatatg |
30705003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 31104882 - 31104929
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| | ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
31104882 |
cccgtgagcttagttcagttgatagggatattacatattatatgcagg |
31104929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 216
Target Start/End: Complemental strand, 31789618 - 31789587
Alignment:
| Q |
185 |
tggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31789618 |
tggtagggatattgcatattatatgcaggagc |
31789587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 33697183 - 33697136
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
33697183 |
cccgtgagcttaactcagttgatagggatattgcattttatatgcagg |
33697136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 209
Target Start/End: Complemental strand, 2500583 - 2500541
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||| |||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
2500583 |
ccgtgtgcttagcttagttggtagggatattgcatattatatg |
2500541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 7328716 - 7328670
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||| |||| |
|
|
| T |
7328716 |
ccgtgagcttaactcagttggtagggatattgcattttatatccagg |
7328670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 212
Target Start/End: Complemental strand, 13158763 - 13158733
Alignment:
| Q |
182 |
agttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13158763 |
agttggtagggatattgcatattatatgcag |
13158733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 212
Target Start/End: Complemental strand, 13163619 - 13163589
Alignment:
| Q |
182 |
agttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13163619 |
agttggtagggatattgcatattatatgcag |
13163589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 208
Target Start/End: Complemental strand, 19618798 - 19618756
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
|||||||| || ||||| ||||||||||||||||||||||||| |
|
|
| T |
19618798 |
cccgtgagtttagctcaattggtagggatattgcatattatat |
19618756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 23610388 - 23610342
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||| | |||||||| |
|
|
| T |
23610388 |
ccgtgagcttagctcagttggtagggacattgcataatttatgcagg |
23610342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 1435811 - 1435856
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| |||||| |||||||||||| ||||||||||||||| |
|
|
| T |
1435811 |
cgtgagcttaactcagtaggtagggatattacatattatatgcagg |
1435856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 2688648 - 2688607
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
|||| ||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
2688648 |
ccgttagcttagctcagttggtaaggatattgcatattatat |
2688607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 180 - 213
Target Start/End: Original strand, 5694928 - 5694961
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
5694928 |
tcagttggtagggatattgtatattatatgcagg |
5694961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 7425380 - 7425425
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||| ||| ||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
7425380 |
cgtgagtttgactcagtttgtagggatattccatattatatgcagg |
7425425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 178 - 215
Target Start/End: Original strand, 11301379 - 11301416
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
11301379 |
gctcagttgataggaatattgcatattatatgcaggag |
11301416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 14579356 - 14579307
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||| || ||| | ||||||||||||||||| |||||||||||||| |
|
|
| T |
14579356 |
cccgtgagtttagcttatttggtagggatattgcaaattatatgcaggag |
14579307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 179 - 216
Target Start/End: Original strand, 15285556 - 15285593
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
15285556 |
ctcagttggtagggatattacatattatatgcatgagc |
15285593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 30938390 - 30938435
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| |||||||||| |
|
|
| T |
30938390 |
cgtgagcttaactcagttggtagggacattgcataatatatgcagg |
30938435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 209
Target Start/End: Original strand, 32837344 - 32837385
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||| ||||||||| |||||||||| ||||||||||| |
|
|
| T |
32837344 |
cgtgagcttagctcagttgctagggatattacatattatatg |
32837385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 215
Target Start/End: Complemental strand, 9888582 - 9888546
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
9888582 |
ctcagttggtagggatattgtatattctatgcaggag |
9888546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 5e-18; HSPs: 135)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 1570262 - 1570212
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1570262 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
1570212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 4482668 - 4482618
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4482668 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
4482618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 6438134 - 6438084
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6438134 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
6438084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 15819671 - 15819621
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15819671 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
15819621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 16343028 - 16343078
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16343028 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
16343078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 25999850 - 25999900
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25999850 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
25999900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 40519614 - 40519564
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40519614 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
40519564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 46965740 - 46965790
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46965740 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
46965790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 50899580 - 50899530
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50899580 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
50899530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 167 - 216
Target Start/End: Original strand, 2277755 - 2277804
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2277755 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
2277804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 6702576 - 6702625
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6702576 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
6702625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 9866256 - 9866207
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9866256 |
atcccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
9866207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 26584816 - 26584767
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26584816 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
26584767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 32594251 - 32594300
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32594251 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
32594300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 33254728 - 33254777
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33254728 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
33254777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 33274900 - 33274949
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33274900 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
33274949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 167 - 216
Target Start/End: Original strand, 34058215 - 34058264
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34058215 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
34058264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 3269619 - 3269666
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3269619 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
3269666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 7166297 - 7166250
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7166297 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
7166250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 8865854 - 8865901
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8865854 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
8865901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 21265656 - 21265703
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21265656 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
21265703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 22563386 - 22563433
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22563386 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
22563433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 33207205 - 33207252
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33207205 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
33207252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 35605693 - 35605646
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35605693 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
35605646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 42490480 - 42490433
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42490480 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
42490433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 1151759 - 1151809
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1151759 |
cccgtgagcttagctcagttggtagggatattgcatattatatacaggagc |
1151809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 212
Target Start/End: Complemental strand, 10664864 - 10664818
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10664864 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcag |
10664818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 11215002 - 11215048
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11215002 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
11215048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 13773168 - 13773218
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13773168 |
cccgtgagtttagctcagttggtagggatattgcatattatatgcaggagc |
13773218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 16526247 - 16526197
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16526247 |
cccgtgagcttagctcaattggtagggatattgcatattatatgcaggagc |
16526197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 40375385 - 40375335
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40375385 |
cccgtgagcatagctcagttggtagggatattgcatattatatgcaggagc |
40375335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 43884794 - 43884844
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43884794 |
cccgtgagtttagctcagttggtagggatattgcatattatatgcaggagc |
43884844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 6130103 - 6130054
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6130103 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
6130054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 37662625 - 37662580
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37662625 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
37662580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 168 - 216
Target Start/End: Original strand, 52369599 - 52369647
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52369599 |
cgtgagtttagctcagttggtagggatattgcatattatatgcaggagc |
52369647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 1836503 - 1836550
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1836503 |
cccgtgagcttagctcagttggtagggatattacatattatatgcagg |
1836550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 2556556 - 2556603
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2556556 |
cccgtaagcttagctcagttggtagggatattgcatattatatgcagg |
2556603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 6893307 - 6893260
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6893307 |
cccgtgagcttagctcagttggtagggatattgcattttatatgcagg |
6893260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 165 - 216
Target Start/End: Original strand, 15775738 - 15775789
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15775738 |
tcccgtgagcttaactcaattggtagggatattgcatattatatgcaggagc |
15775789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 18467268 - 18467221
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18467268 |
cccgtgagcatagctcagttggtagggatattgcatattatatgcagg |
18467221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 18551703 - 18551656
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18551703 |
cccgtgagcttagctcagttggtatggatattgcatattatatgcagg |
18551656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 165 - 212
Target Start/End: Complemental strand, 32557000 - 32556953
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
32557000 |
tcccgtgagcttagctcagctggtagggatattgcatattatatgcag |
32556953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 42054333 - 42054376
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42054333 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
42054376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 47402733 - 47402686
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47402733 |
cccgtgagcttagctcagctggtagggatattgcatattatatgcagg |
47402686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 48638532 - 48638579
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48638532 |
cccgtgagcttagctcagttggtagggatattgcattttatatgcagg |
48638579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 51050190 - 51050237
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51050190 |
cccgtgagcttagctcagttggtagggatattgtatattatatgcagg |
51050237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 2352635 - 2352585
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
2352635 |
cccgtgagcttagctcagttgatagagatattgcatattatatgcaggagc |
2352585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 19011356 - 19011402
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19011356 |
ccgtgagcttagctcaattggtagggatattgcatattatatgcagg |
19011402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 23545524 - 23545474
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23545524 |
cccgtgagctaagcttagttggtagggatattgcatattatatgcaggagc |
23545474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 26550494 - 26550544
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26550494 |
cccgtgagcttaactcagttggtagggatattgcatactatatgcaggagc |
26550544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 178 - 216
Target Start/End: Original strand, 29188648 - 29188686
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29188648 |
gctcagttggtagggatattgcatattatatgcaggagc |
29188686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 170 - 216
Target Start/End: Complemental strand, 46161189 - 46161143
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46161189 |
tgagcttagctcagttggtaggaatattgcatattatatgcaggagc |
46161143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 52426982 - 52426936
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52426982 |
ccgtgagcttagctcagttgatagggatattgcatattatatgcagg |
52426936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 163 - 216
Target Start/End: Complemental strand, 3694988 - 3694935
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||| |||||||| |||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
3694988 |
tatccggtgagcttagctcagttggaagggatattgcatattatatgtaggagc |
3694935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 8415731 - 8415776
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8415731 |
cgtgagcttagctcagttcgtagggatattgcatattatatgcagg |
8415776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 167 - 216
Target Start/End: Complemental strand, 8984574 - 8984525
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8984574 |
ccgtgagcttaactcagttggcagggatattgcatattatatgcaggagc |
8984525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 178 - 215
Target Start/End: Complemental strand, 12502312 - 12502275
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12502312 |
gctcagttggtagggatattgcatattatatgcaggag |
12502275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 37403193 - 37403148
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
37403193 |
cgtgagcttggctcagttagtagggatattgcataatatatgcagg |
37403148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 40520830 - 40520875
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
40520830 |
cccgtgagtttagctcagttggtagggatattgcatattatatgca |
40520875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 42299581 - 42299536
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
42299581 |
cgtgagcttagttcagttggtagggatattgcatattatatgcagg |
42299536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 44732633 - 44732678
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44732633 |
cccgtgagcttaactcagttggtagggatattgcatattatatgca |
44732678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 166 - 210
Target Start/End: Original strand, 2754360 - 2754404
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgc |
210 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
2754360 |
cccgtgagcttagcttagttggtagggatattgcatattatatgc |
2754404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 15390219 - 15390267
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15390219 |
tcccgtgagcttaactcagttggtagggatattgcatattagatgcagg |
15390267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 18534002 - 18534050
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
18534002 |
ccgtgagcttagctcagttggtagagatattgcatattatatgtaggag |
18534050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 46225390 - 46225434
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46225390 |
gtgagcttagctcagttggtagggatattgcattttatatgcagg |
46225434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 180 - 216
Target Start/End: Complemental strand, 50824466 - 50824430
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50824466 |
tcagttggtagggatattgcatattatatgcaggagc |
50824430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 170 - 214
Target Start/End: Original strand, 51933510 - 51933554
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagga |
214 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
51933510 |
tgagcttagctcaattggtagggatattgcatattatatgcagga |
51933554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 7180684 - 7180637
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7180684 |
cccgtgaggttagctcagttggtaggaatattgcatattatatgcagg |
7180637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 14760819 - 14760771
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14760819 |
cccgtgagcttagctcagttggtag--atattgcatattatatgcaggagc |
14760771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 212
Target Start/End: Complemental strand, 42848802 - 42848755
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||| ||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42848802 |
tcccatgagcttagctcagttgatagggatattgcatattatatgcag |
42848755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 178 - 213
Target Start/End: Complemental strand, 47930729 - 47930694
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47930729 |
gctcagttggtagggatattgcatattatatgcagg |
47930694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 181 - 215
Target Start/End: Complemental strand, 923159 - 923125
Alignment:
| Q |
181 |
cagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
923159 |
cagttggtagggatattgcatattatatgcaggag |
923125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 7191033 - 7191079
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||| ||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7191033 |
ccgtgaccttagctcagttgatagggatattgcatattatatgcagg |
7191079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 18216906 - 18216956
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||| |||||| |||| |
|
|
| T |
18216906 |
cccgtgagcttagctcagttggtagggatattacatattttatgcaagagc |
18216956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 24874970 - 24875016
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| | |||||| |
|
|
| T |
24874970 |
tcccgtgagcttagctcagttggtagggatattgcataatttatgca |
24875016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 170 - 208
Target Start/End: Original strand, 27818573 - 27818611
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatat |
208 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27818573 |
tgagcttagctcagttggtagggatattgcatattatat |
27818611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 33033127 - 33033173
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33033127 |
ccgtgagcttaattcagttggtagggatattgcatattatatgcagg |
33033173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 178 - 216
Target Start/End: Complemental strand, 34580844 - 34580806
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34580844 |
gctcagttggtagggatattgtatattatatgcaggagc |
34580806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 179 - 213
Target Start/End: Original strand, 40634214 - 40634248
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40634214 |
ctcagttggtagggatattgcatattatatgcagg |
40634248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 46021949 - 46021899
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| | ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46021949 |
cccgtgagcgtagctcagtaagtagggatattgcatattatatgcaggagc |
46021899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 6712177 - 6712132
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
6712177 |
cgtgagcttagctcagttggtaggtatattgcattttatatgcagg |
6712132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 180 - 213
Target Start/End: Complemental strand, 13538502 - 13538469
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
13538502 |
tcagttggtagggatattgcatattatatgcagg |
13538469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 212
Target Start/End: Original strand, 17580314 - 17580363
Alignment:
| Q |
163 |
tatcccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||| |||| ||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
17580314 |
tatcctgtgaacttagctcagttggtagggatattgcatgttatatgcag |
17580363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 172 - 213
Target Start/End: Complemental strand, 27642790 - 27642749
Alignment:
| Q |
172 |
agcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27642790 |
agcttagctcagttggtagggatattgcattttatatgcagg |
27642749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 180 - 213
Target Start/End: Original strand, 27650711 - 27650744
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27650711 |
tcagttggtagggatattgcatattatatgcagg |
27650744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 180 - 213
Target Start/End: Original strand, 45271780 - 45271813
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45271780 |
tcagttggtagggatattgcatattatatgcagg |
45271813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 209
Target Start/End: Complemental strand, 47478916 - 47478875
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47478916 |
cgtgagcttaactcagttggtagggatattgcatattatatg |
47478875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 15595726 - 15595770
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||| |||||||| |
|
|
| T |
15595726 |
ccgtgagcttagctcagttggtagggacattgcataatatatgca |
15595770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 16182199 - 16182243
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||||| ||| ||||||||| |||||||||||||||||||| |
|
|
| T |
16182199 |
ccgtgagcttagctgagttggtagagatattgcatattatatgca |
16182243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 216
Target Start/End: Complemental strand, 16313774 - 16313726
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
16313774 |
cgtgagcttaactcaattggtaggaatattgcatattatatgcaggagc |
16313726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 209
Target Start/End: Original strand, 25034903 - 25034947
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||| ||||||| |
|
|
| T |
25034903 |
tcccgtgagcttagctcagttggtaggaatattgcattttatatg |
25034947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 25580689 - 25580737
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
25580689 |
ccgtgagcttaactcagttggtagagatattgcatattatatgccggag |
25580737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 42550080 - 42550032
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| ||||| | |||||||||||||||||||| ||||||| |
|
|
| T |
42550080 |
tcccgtgagcttagctcaatcggtagggatattgcatattacatgcagg |
42550032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 214
Target Start/End: Complemental strand, 43668027 - 43667979
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagga |
214 |
Q |
| |
|
||||| ||||| |||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
43668027 |
cccgtaagcttagctcagttcgtagagatattgcatattatatgcagga |
43667979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 44019277 - 44019321
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||| ||||||||| |
|
|
| T |
44019277 |
ccgtgagcttagctcagttgatagggatattgcattttatatgca |
44019321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 4553616 - 4553569
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
4553616 |
cccgtgagcttaactcagttggtagaaatattgcatattatatgcagg |
4553569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 5190847 - 5190804
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
5190847 |
tgagcttagctcaattggtagggatatcgcatattatatgcagg |
5190804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 6463102 - 6463059
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||||||||||||||||||||| || ||||||||||| |
|
|
| T |
6463102 |
tgagcttagctcagttggtagggatattgtattttatatgcagg |
6463059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 11065120 - 11065167
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||| || ||| |||||||||||||||||||||| |
|
|
| T |
11065120 |
cccgtgagcttagctcagatgatagagatattgcatattatatgcagg |
11065167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 12404356 - 12404403
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| || | ||| |||||||||||||||||||||||||||||| |
|
|
| T |
12404356 |
cccgtgagattagatcaattggtagggatattgcatattatatgcagg |
12404403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 17671480 - 17671433
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| | ||||||||| |
|
|
| T |
17671480 |
cccgtgagcttagctcagttggtagggatatcgcatttcatatgcagg |
17671433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 213
Target Start/End: Original strand, 24253784 - 24253819
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24253784 |
gctcatttggtagggatattgcatattatatgcagg |
24253819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 216
Target Start/End: Complemental strand, 31401316 - 31401265
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||||||||| ||||||||| |||||| |||||||| | ||||||||||| |
|
|
| T |
31401316 |
tcccgtgagcttagctcagttgatagggacattgcataatttatgcaggagc |
31401265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 34271844 - 34271891
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| || |||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
34271844 |
cccgtgagtttagctcagctggtagggatattacatattatatgcagg |
34271891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 213
Target Start/End: Complemental strand, 36314037 - 36314002
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36314037 |
gctcagttggtagggatattgcatattatttgcagg |
36314002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 36666646 - 36666599
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| | |||||||| |
|
|
| T |
36666646 |
cccgtgagcttagctcagttggtagggacattgcataatttatgcagg |
36666599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 216
Target Start/End: Original strand, 36726560 - 36726611
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| || ||||||||| |||| |||||| ||||||||||||||||| |
|
|
| T |
36726560 |
tcccgtgagtttagctcagttgataggaatattgtatattatatgcaggagc |
36726611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 45333781 - 45333735
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||| |||||||||| |
|
|
| T |
45333781 |
cccgtgagcttagctcagttggcagggatattgcata-tatatgcagg |
45333735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 48897187 - 48897140
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||| |||||||| ||||||||||||||||||||| |
|
|
| T |
48897187 |
cccgtgagcttaactcatttggtaggaatattgcatattatatgcagg |
48897140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 49253610 - 49253656
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
49253610 |
cccgtgagcttagctaagttggtagg-atattgcatattatatgcagg |
49253656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 213
Target Start/End: Original strand, 8780781 - 8780815
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8780781 |
ctcagttggtacggatattgcatattatatgcagg |
8780815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 212
Target Start/End: Complemental strand, 12650454 - 12650408
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
||||||| ||| |||||||||||| ||||||||||| |||||||||| |
|
|
| T |
12650454 |
cccgtgaacttagctcagttggtaaggatattgcatgttatatgcag |
12650408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 209
Target Start/End: Original strand, 28867480 - 28867522
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||| ||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
28867480 |
ccgtgaacttagctcagttggtaggaatattgcatattatatg |
28867522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 216
Target Start/End: Original strand, 31818598 - 31818644
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||| | ||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
31818598 |
tgagcttagttcagttgctaggaatattgcatattatatgcaggagc |
31818644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 41709992 - 41709946
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||| | ||||||||||| |
|
|
| T |
41709992 |
ccgtgagcttagcttagttggtagggatattgcgtgttatatgcagg |
41709946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Complemental strand, 45517337 - 45517291
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||| |||||| |||| |
|
|
| T |
45517337 |
ccgtgagcttagttcagttggtagggatattgcattttatatacagg |
45517291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 179 - 213
Target Start/End: Original strand, 51942308 - 51942342
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
51942308 |
ctcagttggtagggatattgcatattatatacagg |
51942342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 3560449 - 3560404
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
3560449 |
cgtgagcttaactcagttggtagggatattatatattatatgcagg |
3560404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 10851826 - 10851871
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| ||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
10851826 |
cgtgagcttagctcaattggtaaggatattgtatattatatgcagg |
10851871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 167 - 212
Target Start/End: Complemental strand, 12182083 - 12182038
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||| || ||||||| |
|
|
| T |
12182083 |
ccgtgagctttgctcagttggtaggaatattgcatgttgtatgcag |
12182038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 209
Target Start/End: Original strand, 14349646 - 14349687
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||| ||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
14349646 |
cgtgaacttagctcagttggtagagatattgcatattatatg |
14349687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 20030080 - 20030125
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
20030080 |
cgtgagcttatctcagttggtaggaatattgcattttatatgcagg |
20030125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 168 - 209
Target Start/End: Original strand, 27344481 - 27344522
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
27344481 |
cgtgagcttagctcagttggtagacatattgcatattatatg |
27344522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 178 - 215
Target Start/End: Original strand, 29527126 - 29527163
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
29527126 |
gctcagttggtatggatattgtatattatatgcaggag |
29527163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 179 - 212
Target Start/End: Complemental strand, 49425035 - 49425002
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
49425035 |
ctcaattggtagggatattgcatattatatgcag |
49425002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 216
Target Start/End: Complemental strand, 30451 - 30415
Alignment:
| Q |
180 |
tcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
30451 |
tcagttagtagggatattgcattttatatgcaggagc |
30415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 213
Target Start/End: Complemental strand, 3768032 - 3767996
Alignment:
| Q |
178 |
gctcagttggtagggatattgcata-ttatatgcagg |
213 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3768032 |
gctcagttggtagggatattgcatatttatatgcagg |
3767996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 213
Target Start/End: Original strand, 6213424 - 6213468
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||| ||| ||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
6213424 |
gtgaacttagctcaattggtagggatattgcatattatatacagg |
6213468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 24874137 - 24874185
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| ||||||||| |||||| |||||||| | |||||||| |
|
|
| T |
24874137 |
tcccgtgagcttagctcagttgatagggacattgcataatttatgcagg |
24874185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 28564416 - 28564368
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||| ||||| ||||||| |||||||||||||| |||||||||||| |
|
|
| T |
28564416 |
tcccgtaagcttaactcagttagtagggatattgcagattatatgcagg |
28564368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 216
Target Start/End: Original strand, 29204647 - 29204695
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||| | |||||| |||| |
|
|
| T |
29204647 |
cgtgagcttagctcagttggtagggacattgcataatttatgcaagagc |
29204695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 34656466 - 34656418
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| || ||||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
34656466 |
tcccgtgagtttagctcagttgatagagatattgcattttatatgcagg |
34656418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 213
Target Start/End: Complemental strand, 35121116 - 35121072
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||| ||| ||||||||| |||||||||||||| ||||||| |
|
|
| T |
35121116 |
gtgagcttagcttagttggtagcgatattgcatattacatgcagg |
35121072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 214
Target Start/End: Original strand, 38032204 - 38032252
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagga |
214 |
Q |
| |
|
||||||| ||| | |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
38032204 |
cccgtgaacttagatcagctggtagggatattgcatattgtatgcagga |
38032252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 42472274 - 42472230
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
42472274 |
tcccgtgagtttgactcagttgacagggatattgcatattatatg |
42472230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 4084 - 4035
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4084 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
4035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 46526 - 46573
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46526 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
46573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 168 - 216
Target Start/End: Original strand, 11996 - 12044
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11996 |
cgtgaacttagctcagttggtagggatattgcatattatatgcaggagc |
12044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 10896 - 10849
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10896 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
10849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 112108 - 112158
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
112108 |
cccgtgagcttaactcagttggtagggatattgcatattatatgcaggagc |
112158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 12332 - 12286
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12332 |
tcccgtgagcttagctcagttggtagggatattgcatattatatgca |
12286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1185 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold1185
Description:
Target: scaffold1185; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 2443 - 2394
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2443 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
2394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 165 - 214
Target Start/End: Original strand, 3665 - 3714
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagga |
214 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3665 |
tcccgtgagcttaactcagttggtagggatattgcatattatatgcagga |
3714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 12459 - 12508
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12459 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
12508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 13275 - 13226
Alignment:
| Q |
164 |
atcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||| ||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13275 |
atcctgtgcgcttagctcagttggtagggatattgcatattatatgcagg |
13226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 168 - 216
Target Start/End: Complemental strand, 37482 - 37434
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37482 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagc |
37434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 212
Target Start/End: Original strand, 23360 - 23407
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23360 |
tcccgtgaacttaactcagttggtagggatattgcatattatatgcag |
23407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 21264 - 21311
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21264 |
cccgtgagcttagcttagttggtagggatattgcatattatatgcagg |
21311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 8821 - 8868
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8821 |
cccgtgagcttagctcagttggtagggatattgcattttatatgcagg |
8868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 15766 - 15813
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15766 |
cgtgagcttatctcagttggtagggatattgcatattatatgcaggag |
15813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 166 - 213
Target Start/End: Complemental strand, 8895 - 8848
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8895 |
cccgtgagcttagctcagttggtagggatattgcatattttatgcagg |
8848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 178 - 216
Target Start/End: Complemental strand, 11178 - 11140
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11178 |
gctcagttggtagggatattgcatattatatgcaggagc |
11140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 178 - 216
Target Start/End: Complemental strand, 21506 - 21468
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgcaggagc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21506 |
gctcagttggtagggatattgcatattatatgcaggagc |
21468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0517
Description:
Target: scaffold0517; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 213
Target Start/End: Original strand, 4883 - 4928
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
4883 |
cgtgagcttggctcagttagtagggatattgcataatatatgcagg |
4928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1372 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold1372
Description:
Target: scaffold1372; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 213
Target Start/End: Original strand, 1871 - 1911
Alignment:
| Q |
173 |
gcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1871 |
gcttagctcagttggtagggatattgcatattatatgcagg |
1911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0100 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 166 - 206
Target Start/End: Original strand, 45884 - 45924
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattat |
206 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45884 |
cccgtgagcttagctcagttggtagggatattgcatattat |
45924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 209
Target Start/End: Complemental strand, 65854 - 65814
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
65854 |
gtgagcttagctcagttggtagggatattgcatattatatg |
65814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 169 - 215
Target Start/End: Complemental strand, 3660 - 3614
Alignment:
| Q |
169 |
gtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
3660 |
gtgagcttagctcagttggtagggatatttcatattatatgccggag |
3614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0394 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0394
Description:
Target: scaffold0394; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 1261 - 1311
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
1261 |
tcccgtgagcttaactcagttggtaggaatattgtatattatatgcaggag |
1311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 165 - 215
Target Start/End: Original strand, 1316 - 1366
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
1316 |
tcccgtgagcttaactcagttggtaggaatattgtatattatatgcaggag |
1366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 213
Target Start/End: Complemental strand, 27998 - 27953
Alignment:
| Q |
168 |
cgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
27998 |
cgtgagcttagctcggttggtagggatattgcattttatatgcagg |
27953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0330 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0330
Description:
Target: scaffold0330; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 215
Target Start/End: Original strand, 6781 - 6817
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcaggag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6781 |
ctcagttggtagggatattgcatattatatgtaggag |
6817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 56322 - 56370
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||||||||||||||||| |
|
|
| T |
56322 |
tcccgtgagcttaactcaattggcagggatattgcatattatatgcagg |
56370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 50072 - 50028
Alignment:
| Q |
165 |
tcccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
50072 |
tcccgtgagcttaactcagttgatagggatattgcatattatatg |
50028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 400 - 447
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||| ||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
400 |
cccgtgaacttagctcaattgatagggatattgcatattatatgcagg |
447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1709 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold1709
Description:
Target: scaffold1709; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 175 - 218
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
175 |
tgagcttagctcagttggtatagatattgcatattatatgcagg |
218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1331 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold1331
Description:
Target: scaffold1331; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 213
Target Start/End: Complemental strand, 146 - 103
Alignment:
| Q |
170 |
tgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
146 |
tgagcttagctcagttggtatagatattgcatattatatgcagg |
103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 209
Target Start/End: Original strand, 5982 - 6025
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatg |
209 |
Q |
| |
|
||||||||||| ||||| ||| |||||||||||||||||||||| |
|
|
| T |
5982 |
cccgtgagcttagctcatttgatagggatattgcatattatatg |
6025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 315649 - 315696
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
||||||| ||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
315649 |
cccgtgaacttagctcagttggtaaggatattgcattttatatgcagg |
315696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 15006 - 15052
Alignment:
| Q |
167 |
ccgtgagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||| | |||||||| |
|
|
| T |
15006 |
ccgtgagcttagctcagttggtagggacattgcataatttatgcagg |
15052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 59243 - 59201
Alignment:
| Q |
171 |
gagcttggctcagttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
59243 |
gagcttagttcagttggtagagatattgcatattatatgcagg |
59201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0199 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0199
Description:
Target: scaffold0199; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 179 - 212
Target Start/End: Complemental strand, 8973 - 8940
Alignment:
| Q |
179 |
ctcagttggtagggatattgcatattatatgcag |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
8973 |
ctcaattggtagggatattgcatattatatgcag |
8940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 184 - 213
Target Start/End: Original strand, 39664 - 39693
Alignment:
| Q |
184 |
ttggtagggatattgcatattatatgcagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39664 |
ttggtagggatattgcatattatatgcagg |
39693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 178 - 211
Target Start/End: Original strand, 510968 - 511001
Alignment:
| Q |
178 |
gctcagttggtagggatattgcatattatatgca |
211 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
510968 |
gctcagttagtagggatattgcatattatatgca |
511001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 206
Target Start/End: Complemental strand, 236425 - 236385
Alignment:
| Q |
166 |
cccgtgagcttggctcagttggtagggatattgcatattat |
206 |
Q |
| |
|
|||||||| || | ||||||||||||||||||||||||||| |
|
|
| T |
236425 |
cccgtgagattagttcagttggtagggatattgcatattat |
236385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University