View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1937-Insertion-12 (Length: 109)
Name: NF1937-Insertion-12
Description: NF1937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1937-Insertion-12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 2e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 8 - 104
Target Start/End: Original strand, 6080305 - 6080401
Alignment:
| Q |
8 |
tttccaacgcttagccccgtcgcccgtaccgccaccaagcttctccgatcaccgttgaggtacggcttttattcttaagcatcttattgccaacaaa |
104 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6080305 |
tttccaacgcttagccccgtcgcccttaccgccaccaagcttctccgatcaccgttgaggtacggcttttattcttaagcatcttattgtcaacaaa |
6080401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 45 - 91
Target Start/End: Complemental strand, 35011927 - 35011881
Alignment:
| Q |
45 |
agcttctccgatcaccgttgaggtacggcttttattcttaagcatct |
91 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| || ||||||||| |
|
|
| T |
35011927 |
agcttctccgaccaccgttgaggtacggcttttaatcctaagcatct |
35011881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University