View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1937-Insertion-6 (Length: 244)
Name: NF1937-Insertion-6
Description: NF1937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1937-Insertion-6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 230
Target Start/End: Complemental strand, 26736557 - 26736338
Alignment:
| Q |
14 |
ttttgcagcatcagttggaagctattaagtcagctacatcggttgcaattggaccaatatcggtcagttcaaattttaatgcagttttgattatttttaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
26736557 |
ttttgcagcatcagttggaagctattaagtcagctacatcggttgcagttggaccaatatcggtcagtccaaattctaatgcagttttgattatttttaa |
26736458 |
T |
|
| Q |
114 |
aaattaaaatactgaacttaaaatttggactgtccgatcttgatacaacaaccattgatgtcattaacagtgtggcttcacaggattgtcactacacaca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26736457 |
aaattaaaatactgaacttaaaatttggactgtccgatcttgatacaacaaccactgatgtcactaacagtgtggcttcacaggattgtcactacacaca |
26736358 |
T |
|
| Q |
214 |
acc---atccacaccggtta |
230 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
26736357 |
acccaaatccacaccggtta |
26736338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 162
Target Start/End: Original strand, 51188136 - 51188191
Alignment:
| Q |
107 |
tttttaaaaattaaaatactgaacttaaaatttggactgtccgatcttgatacaac |
162 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||| || ||||||||| |||| |
|
|
| T |
51188136 |
tttttaaaaataaaaatactgaacttaaagtttggactatcagatcttgatccaac |
51188191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University