View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19370_high_2 (Length: 348)
Name: NF19370_high_2
Description: NF19370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19370_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 8 - 326
Target Start/End: Original strand, 14859367 - 14859685
Alignment:
| Q |
8 |
gtcaattcggtcgcaagccttgctaatgtctagcttatgtgcaacatatgatgaaccacttcaattgcaattatggcattgtcaagaattgaccggcctg |
107 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14859367 |
gtcaattcggtcgtaagccttgctaatgtctagcttatgtgcaacatatgatgaaccgcttcaattgcaattatggcattgtcaagaattgaccggcctg |
14859466 |
T |
|
| Q |
108 |
gaacaaaagcaaattggttatcataaatacatttatggaggatgtgatttagcctgttagccaacacttttgcgagcaatttatacaacacattacactg |
207 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
14859467 |
gaacaaaagcaaattggctatcataaatacatttatggaggatgtgttttagcctgttagccaacacttttgcgagcaatttatacaacacattacacgg |
14859566 |
T |
|
| Q |
208 |
cgcaattggacgccagtccctcattgacttcttctcatccgcattcgaaataagtgtaatatttatggaattaagtgagggatggaattgattattgttg |
307 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14859567 |
cgcaattggacgccagtcccacattgacttcttctcatccgcattcgaaataagtgtaatatttgtggaattaagtgagggatggaattgattattgttg |
14859666 |
T |
|
| Q |
308 |
agccatatacatcactcct |
326 |
Q |
| |
|
||||| | ||||||||||| |
|
|
| T |
14859667 |
agccacacacatcactcct |
14859685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University