View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19370_low_5 (Length: 268)
Name: NF19370_low_5
Description: NF19370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19370_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 12 - 254
Target Start/End: Original strand, 14443423 - 14443665
Alignment:
| Q |
12 |
atgacttgatataaaaaagaaagataatttacttttcaacattgacaaaggaattgggtgagaaagtggagagggannnnnnngtgccattgggtgagaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14443423 |
atgacttgatataaaaaagaaagataatttacttttcaacattgacaaaggaattgggtgagaaagtggagagggatttttttgtgccattgggtgagaa |
14443522 |
T |
|
| Q |
112 |
aggagacgaaccattagtagtagcaaccaccatattttgtgtctcactatcactcttgattggtgtttggtttatttttatttattttgccgttgtgtct |
211 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14443523 |
aggagaagaaacattagtagtagcaaccaccatattttgtgtctcactatcactcttgattggtgtttggtttatttttatttattttgccgttgtgtct |
14443622 |
T |
|
| Q |
212 |
gcatacatatatatagggagagagtgctttctaatgtgaagga |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14443623 |
gcatacatatatatagggagagagtgctttctaatgtgaagga |
14443665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University