View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19371_low_12 (Length: 304)
Name: NF19371_low_12
Description: NF19371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19371_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 106 - 290
Target Start/End: Original strand, 45828067 - 45828250
Alignment:
| Q |
106 |
aagtctagagaaaacgttagaaatttatttggctaacaaagaggttcctatcagatagtttaaaatattattcattgatctatggactactacgactaca |
205 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45828067 |
aagtctagagaaaacgttagaaatt-atttggctaacaaagaggttcctatcagatagtttaaaatattattcattgatctatggactactacgactaca |
45828165 |
T |
 |
| Q |
206 |
aatgacacttttaatggcgaaaatgattacttttaagaccagataagcaaagttcatcttttaatcgaagataagagaagattct |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45828166 |
aatgacacttttaatggcgaaaatgattacttttaagaccagataagcaaagttcatcttttaatcgaagataagagaagattct |
45828250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 93 - 123
Target Start/End: Original strand, 45828019 - 45828049
Alignment:
| Q |
93 |
aacaaacggtttcaagtctagagaaaacgtt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45828019 |
aacaaacggtttcaagtctagagaaaacgtt |
45828049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University