View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19371_low_16 (Length: 255)
Name: NF19371_low_16
Description: NF19371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19371_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 37047279 - 37047125
Alignment:
| Q |
1 |
ccgatgacaacactagcacacataataagataactttttgaataaatggagacattgcaacttaggttaatcttttgcttagaagcaggggctgacctgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
37047279 |
ccgatgacaacactagcacacataataagataactttttgaataaatggagacattgcaacttaggttaatcttttgcttagaagcaggggcggaccagg |
37047180 |
T |
|
| Q |
101 |
accttcaatattgattgactgctttctgcctacgagttttataggaaatacaagt |
155 |
Q |
| |
|
| ||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37047179 |
atcttcaatatcgattgactgctttctgcctatgagttttataggaaatacaagt |
37047125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 152 - 237
Target Start/End: Complemental strand, 37046850 - 37046765
Alignment:
| Q |
152 |
aagtttttgtatctcacaagactatgtcattttgcataatatgtagataactttcaaactgattgaaaccattatgacgtacatat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37046850 |
aagtttttgtatctcacaagactatgtcattttgcataatatgtagataactttcaaactgattgaaaccattatgacgtatatat |
37046765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 155 - 229
Target Start/End: Complemental strand, 6590854 - 6590783
Alignment:
| Q |
155 |
tttttgtatctcacaagactatgtcattttgcataatatgtagataactttcaaactgattgaaaccattatgac |
229 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||| |||| |||||| |||||| |
|
|
| T |
6590854 |
tttttgtatctcacaagacac---cattttacataatatgtagataactttcaaaccgattcaaaccaatatgac |
6590783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University