View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19371_low_18 (Length: 248)
Name: NF19371_low_18
Description: NF19371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19371_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 21 - 229
Target Start/End: Original strand, 49915712 - 49915932
Alignment:
| Q |
21 |
atcactttatttaaagataaccacaaaactacaattgaattccatccacagaaacaagttagataattaattatgtccttgtcaa-tttgatattgcagc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49915712 |
atcactttatttaaagataaccacaaaactacaattgaattccatccacagaaacaagttagataattaattatgtccttgtcaattttgatattgcagc |
49915811 |
T |
 |
| Q |
120 |
agttgttaatcaccgaccttgtacgaagagtaattgtc--------------annnnnnnaattcattaatttggtcagttgttgttgttgttttaacga |
205 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49915812 |
agttgttaatcactgaccttgtacgaagagtaattgtcatttttttatcataacttttttaattcattaatttggtca---gttgttgttgttttaacga |
49915908 |
T |
 |
| Q |
206 |
agttatgaaatactcttgctttat |
229 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
49915909 |
agttatgaaatactcttgctttat |
49915932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University