View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19371_low_2 (Length: 523)
Name: NF19371_low_2
Description: NF19371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19371_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 480; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 480; E-Value: 0
Query Start/End: Original strand, 1 - 508
Target Start/End: Complemental strand, 36920177 - 36919670
Alignment:
| Q |
1 |
catgcattttgacacattttccttcatcaacatctagcaacaaacaagaacttatgagcttatttttagccacagttacttcgttccttgccccttcata |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36920177 |
catgcattttgacacattttccttcattaacatctagcaacaaacaagaacttatgagcttatttttagccacagttacttcgttccttgccccttcata |
36920078 |
T |
 |
| Q |
101 |
tgagcgaacttctccaactatgccaagccctattgcagacctagttaaaaactccacaggaatttcacaatcttcaggaaatacagaacacaacaagaaa |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36920077 |
tgagtgaacttctccaactatgccaagcccgattgcagacctagttaaaaactccacaggaatttcacaatcttcaggaaatacagaacacaacaagaaa |
36919978 |
T |
 |
| Q |
201 |
agtgacttggcctcttcagtgtccaaattatcatagcttagttgcaagcacttgtacgggttttgcaaacctttttcaatattaacaggttttgaacttc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36919977 |
agtgacttggcctcttcagtgtccaaattatcatagcttagttgcaagcacttgtacgggttttgcaaacctttttcaatattaacaggttttgaacttc |
36919878 |
T |
 |
| Q |
301 |
tcaatctatccaatgccaccttccattccacctcagccttgcctttcaaactgctagccactgctacagtggcgacaggcaagcctttacattcatttga |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36919877 |
tcaatctatccaatgccaccttccattccacctcagccttgcctttcaagctgctagccactgctacagtggcgacaggcaagcctttacattcatttga |
36919778 |
T |
 |
| Q |
401 |
aatttctctagccatattctttatagtaatccaagttccttcagatatgagtgcttgcttctggaaaagatcccacgtttcatcgttggttagtgttgat |
500 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36919777 |
aatttctctagccatattctttatagaaatccaagttccttcagatatcagtgcttgcttttggaaaagatcccacgtttcatcgttggttagtgttgat |
36919678 |
T |
 |
| Q |
501 |
aactgaat |
508 |
Q |
| |
|
|||||||| |
|
|
| T |
36919677 |
aactgaat |
36919670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University