View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19372_high_22 (Length: 316)
Name: NF19372_high_22
Description: NF19372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19372_high_22 |
 |  |
|
| [»] scaffold0531 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 42986992 - 42986696
Alignment:
| Q |
1 |
attttaaaataagagttcctgaatggaaaccgctatatatgttatagttgcacaaaagtaggacagagtgggaagtaaggaagaaagcataaatccaacc |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42986992 |
atttaaaaataagagttcctgaatggaaaccg-tatatatgttatagttgcacaaaagtaggacaaagtgggaagtaaggaagaaagcataaatccaacc |
42986894 |
T |
 |
| Q |
101 |
gtttcaaacaaagaaaacaaaaatggctgaagcaaatatcaacattaaatccaggaacgccaagtgttgctactctgcgtttcataatgtcactgccatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42986893 |
gtttcaaacaaagaaaacaaaaatggctgaagcaaatatcaacattaaatccaggaacgccaagtgttgctactctgcgtttcataatgtcactgccatg |
42986794 |
T |
 |
| Q |
201 |
gttggagctgcagttcttggcttcccctatgctatgtctcagcttggatggttagcattttttctactcaagtttttaatcttcccatttcattcatc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42986793 |
gttggagctgcagttcttggcttcccctatgctatgtctcagcttggatggttagcattttttctactcaagtttttaatcttcccatttcattcatc |
42986696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 220
Target Start/End: Complemental strand, 7980079 - 7980030
Alignment:
| Q |
171 |
tactctgcgtttcataatgtcactgccatggttggagctgcagttcttgg |
220 |
Q |
| |
|
||||| || ||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
7980079 |
tactcagcttttcacaatgtcactgccatggttggagctggtgttcttgg |
7980030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0531 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0531
Description:
Target: scaffold0531; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 230
Target Start/End: Complemental strand, 4012 - 3968
Alignment:
| Q |
186 |
aatgtcactgccatggttggagctgcagttcttggcttcccctat |
230 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
4012 |
aatgtcactgcaatggttggagctggtgttcttggcctcccctat |
3968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University