View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19372_high_29 (Length: 255)
Name: NF19372_high_29
Description: NF19372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19372_high_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 17 - 237
Target Start/End: Original strand, 32209829 - 32210049
Alignment:
| Q |
17 |
ttgagaatattatcagaaacctacttgccacttcaagccttcaagatgaatcagaagttggaagaatctctttctcaacaattccattttcagaatgaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32209829 |
ttgagaatattatcagaaacctacttgccacttcaagccttcaagatgaatcagaagttggaagaatctctttctcaacaattccattttcagaatgaaa |
32209928 |
T |
 |
| Q |
117 |
atgggagcgagacttgagtcgaatttcttcttctaataactcatcaatcactgaatcaacagtttgaagaggagtgttgtgcaatatccttccacggata |
216 |
Q |
| |
|
|| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32209929 |
ataggagcaagacttgagtcgaatttcttcttctaataactcatcaatcactgaatcaacagtttgaagaggagtgtggtgcaatatccttccacggata |
32210028 |
T |
 |
| Q |
217 |
gcttcaaaatcatcgcgaagg |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32210029 |
gcttcaaaatcatcgcgaagg |
32210049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University