View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19372_high_34 (Length: 244)
Name: NF19372_high_34
Description: NF19372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19372_high_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 47796910 - 47797137
Alignment:
| Q |
1 |
ttattttccttatcttttaggttagtgaagtgactagggcacaaacgctccaacaagttcaggtctttctcaacccgatggaacacttccactctttagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47796910 |
ttattttccttatcttttaggttagtgaagtgactagggcacaaacgctccaacaagttcaggtctttctcaacccgatggaacacttccactctttagc |
47797009 |
T |
 |
| Q |
101 |
aaggtgggtggttataatatgtacaattcataggctggaccatgacatcatttcatatgattttactactcaaaaacaataattacgaaactagttgttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47797010 |
aaggtgggtggttataatatgtacaattcataggctggaccaagacatcatttcatatgattttactactcaaaaacaataattacgaaactagttgttc |
47797109 |
T |
 |
| Q |
201 |
aagaatagtgctcaagcacacaatctac |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
47797110 |
aagaatagtgctcaagcacacaatctac |
47797137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 123 - 224
Target Start/End: Original strand, 47802738 - 47802839
Alignment:
| Q |
123 |
acaattcataggctggaccatgacatcatttcatatgattttactactcaaaaacaataattacgaaactagttgttcaagaatagtgctcaagcacaca |
222 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||| |||| |||||||| |||||||||||||| |||||||||||||| | |||| |
|
|
| T |
47802738 |
acaattcataggctggaccatgagatcacttcatatgattttactacttcaaaagaataattatgaaactagttgttccagaatagtgctcaaacgcaca |
47802837 |
T |
 |
| Q |
223 |
at |
224 |
Q |
| |
|
|| |
|
|
| T |
47802838 |
at |
47802839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 4 - 125
Target Start/End: Original strand, 47802583 - 47802703
Alignment:
| Q |
4 |
ttttccttatcttttaggttagtgaagtgactagggcacaaacgctccaacaagttcaggtctttctcaacccgatggaacacttccactctttagcaag |
103 |
Q |
| |
|
||||||||||||||||||| |||||| |||| ||| || ||||||| ||||||||||| ||||| |||||| |||||||| | | |||||| |||||| |
|
|
| T |
47802583 |
ttttccttatcttttaggtaagtgaattgaccaggacatgaacgctctaacaagttcagatctttatcaaccagatggaacgc-tgcactctctagcaat |
47802681 |
T |
 |
| Q |
104 |
gtgggtggttataatatgtaca |
125 |
Q |
| |
|
| | | ||||||||||||||| |
|
|
| T |
47802682 |
gggaatagttataatatgtaca |
47802703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University