View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19372_low_23 (Length: 360)
Name: NF19372_low_23
Description: NF19372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19372_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 87 - 345
Target Start/End: Complemental strand, 43879744 - 43879485
Alignment:
| Q |
87 |
caaaaaggtaatgttcatggtgattcatattgtgaagatgatgagatgcaagaagagaacaactacaaatcttttgtgtctgatgattcttcatcagacc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43879744 |
caaaaaggtaatgttcatggtgattcatattgtgaagatgatgagatgcaagaagagaacaactacaagtcttttgtgtctgatgattcttcatcagacc |
43879645 |
T |
 |
| Q |
187 |
aagagtttgtagatgagaaggaaaagaacaggctcttttgggaagcttgtttggcatcttgattgtattctgatatttttctttct-aatcacttttatg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43879644 |
aagagtttgtagatgagaaggaaaagaacaggctcttttgggaagcttgtttggcatcttgattgtattctgatatttttctttctaaatcacttttatg |
43879545 |
T |
 |
| Q |
286 |
gatttctgataatcacttagaggcatagcatcacttagatgaaagcttccaattgtatct |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43879544 |
gatttctgataatcacttagaggcatagcatcacttagatgaaagcttccaattgtatct |
43879485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 198 - 250
Target Start/End: Original strand, 39986719 - 39986771
Alignment:
| Q |
198 |
gatgagaaggaaaagaacaggctcttttgggaagcttgtttggcatcttgatt |
250 |
Q |
| |
|
||||||| ||||||||| ||| || |||||||||||||||||||||||||| |
|
|
| T |
39986719 |
gatgagatggaaaagaataggaggttctgggaagcttgtttggcatcttgatt |
39986771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University