View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19372_low_30 (Length: 268)
Name: NF19372_low_30
Description: NF19372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19372_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 1 - 181
Target Start/End: Original strand, 48653710 - 48653893
Alignment:
| Q |
1 |
tcattttcttcgatgannnnnnncagtcagagataatagatttttataatggtagcagtgggatacactttactaattttatgaacatgatagaaataat |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48653710 |
tcattttcttcgatgatttttttcagtcagagataatagatttttataatggtagcagtgggatacactttactaattttatgaacatgatagaaataat |
48653809 |
T |
 |
| Q |
101 |
aactatttcgtgtctctcgttagaataaaatataa---tagnnnnnnnagtagtagttagaacgtagaaggggaatatataatt |
181 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48653810 |
aattatttcgtgtctctcgttagaataaaatataatactagttttttgagtagtagttagaacgtagaaggggaatatataatt |
48653893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 176 - 242
Target Start/End: Original strand, 48654679 - 48654745
Alignment:
| Q |
176 |
ataatttactactgctttttatgaatggtgatatagatagtaatcatctcgtttctctcattagaat |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48654679 |
ataatttactactgctttttatgaatggtgatatagatagtaatcatctcgtttctctcattagaat |
48654745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University