View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19372_low_33 (Length: 253)
Name: NF19372_low_33
Description: NF19372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19372_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 28 - 138
Target Start/End: Original strand, 5916092 - 5916198
Alignment:
| Q |
28 |
taatagtgtgtaaaagcagtttttgtaaaattatagtgatatctgattgatttatcttgatttcgattaatagagtgtgatttttaacaccaacaattga |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5916092 |
taatagtgtgtaaaagcagtttttgtaaaattatagtgatatcttatt----tatcttgatttcgattaatagagtgtgatttttaacaccaacaattga |
5916187 |
T |
|
| Q |
128 |
ctcatcaaagt |
138 |
Q |
| |
|
|||||| |||| |
|
|
| T |
5916188 |
ctcatctaagt |
5916198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 135 - 195
Target Start/End: Original strand, 5921338 - 5921401
Alignment:
| Q |
135 |
aagtagtatcagacttgaactcttttagtat---attaaagtttgatttctgactcatgtttat |
195 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5921338 |
aagtagtatcagacttaaactcatttagtatgagattaaagtttgatttctgactcatgtttat |
5921401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University