View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19372_low_45 (Length: 209)
Name: NF19372_low_45
Description: NF19372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19372_low_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 55 - 193
Target Start/End: Complemental strand, 51942545 - 51942409
Alignment:
| Q |
55 |
cacaaaggttatgcatgctcaagtgtaaaatcataattgctcaaaattggctaatgaaataaaaactaattgtttatgatggtatatcttttagttaatt |
154 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51942545 |
cacaaaggttatgtatgctcaagtgtaaaatcataattgctcaaaa--ggctaatgaaataaaaactaattgtttatgatggtatatcttttagttaatt |
51942448 |
T |
 |
| Q |
155 |
aacatgaaataaaagcagtgcatagattgtagggaaaag |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51942447 |
aacatgaaataaaagcagtgcatagattgtagggaaaag |
51942409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University