View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19374_low_6 (Length: 296)
Name: NF19374_low_6
Description: NF19374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19374_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 150 - 280
Target Start/End: Original strand, 26881237 - 26881367
Alignment:
| Q |
150 |
cgtactgtacattagtgtactttgatatctaatgtgataaggcttaaagagctcnnnnnnncatcgtatacaaggagcccccttaaccatatatgcattg |
249 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26881237 |
cgtactgtacattagtgtacgttgatatctaatgtgataaggcttaaagagctcaaaaaaacatcgtatacaaggagcccccttaaccatatatgcattg |
26881336 |
T |
 |
| Q |
250 |
ggaatttggaccaattatcatgtgaatattt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26881337 |
ggaatttggaccaattatcatgtgaatattt |
26881367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 7 - 78
Target Start/End: Original strand, 26881094 - 26881165
Alignment:
| Q |
7 |
atagaataagacaagatttaacaggtaattgtgattaatgttagttaggtcgagttttaagtttttaacatg |
78 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26881094 |
atagaataagacacgatttaacaggtaattgtgattgatgttagttaggtcgagttttaagtttttaacatg |
26881165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University