View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19374_low_8 (Length: 269)

Name: NF19374_low_8
Description: NF19374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19374_low_8
NF19374_low_8
[»] chr1 (2 HSPs)
chr1 (144-243)||(38308420-38308519)
chr1 (1-68)||(38308595-38308662)


Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 144 - 243
Target Start/End: Complemental strand, 38308519 - 38308420
Alignment:
144 gtaggggcgtggctctacgaggcccccctcacccatcaaaaccaatcttctggtaggnnnnnnncctcataactatcgaaatccatcttttgacagatgt 243  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||       ||||||||||||||||||||||||||||||||||||    
38308519 gtaggggcgtggctctacgaggcccccctcacccatcagaaccaatcttctggtaggtttttttcctcataactatcgaaatccatcttttgacagatgt 38308420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 38308662 - 38308595
Alignment:
1 actatacaaattaggattgtatgtggttgaattcaaggacatgatcttgcgtttatgctaaactaccg 68  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
38308662 actatacaaattaggattgcatgtggttgaattcaaggacatgatcttgcgtttatgctaaactaccg 38308595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University