View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19374_low_8 (Length: 269)
Name: NF19374_low_8
Description: NF19374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19374_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 144 - 243
Target Start/End: Complemental strand, 38308519 - 38308420
Alignment:
| Q |
144 |
gtaggggcgtggctctacgaggcccccctcacccatcaaaaccaatcttctggtaggnnnnnnncctcataactatcgaaatccatcttttgacagatgt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38308519 |
gtaggggcgtggctctacgaggcccccctcacccatcagaaccaatcttctggtaggtttttttcctcataactatcgaaatccatcttttgacagatgt |
38308420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 38308662 - 38308595
Alignment:
| Q |
1 |
actatacaaattaggattgtatgtggttgaattcaaggacatgatcttgcgtttatgctaaactaccg |
68 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38308662 |
actatacaaattaggattgcatgtggttgaattcaaggacatgatcttgcgtttatgctaaactaccg |
38308595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University