View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19374_low_9 (Length: 254)
Name: NF19374_low_9
Description: NF19374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19374_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 17 - 137
Target Start/End: Original strand, 43306274 - 43306394
Alignment:
| Q |
17 |
attgatatgtttgcaattctaaaaaataacttcactaagcatatgacacaatcaaagttgagtaaaatgaaatttatcgatttctattaggatgatcatg |
116 |
Q |
| |
|
||||||||||||| |||| | ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43306274 |
attgatatgtttgtaattttcaaaaataacgtcactaagcatatgacacaatcaaagttgagtaaaatgaaatttatcgttttctattaggatgatcatg |
43306373 |
T |
 |
| Q |
117 |
ttatatctctattacctattt |
137 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43306374 |
ttatatctctattacctattt |
43306394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 141 - 240
Target Start/End: Original strand, 43306636 - 43306736
Alignment:
| Q |
141 |
gatgttggtgtttgcactggctcgaatatgataaaatagtggaatcattat-nnnnnnnnntgttaacaaaaacaaagtaaatattctaagaatggatag |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43306636 |
gatgttggtgtttgcactggctcgaatatgataaaatagtggaatcattataaaaaaaaaatgttaacaaaaacaaagtaaatattctaagaatggatag |
43306735 |
T |
 |
| Q |
240 |
a |
240 |
Q |
| |
|
| |
|
|
| T |
43306736 |
a |
43306736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University