View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19374_low_9 (Length: 254)

Name: NF19374_low_9
Description: NF19374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19374_low_9
NF19374_low_9
[»] chr5 (2 HSPs)
chr5 (17-137)||(43306274-43306394)
chr5 (141-240)||(43306636-43306736)


Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 17 - 137
Target Start/End: Original strand, 43306274 - 43306394
Alignment:
17 attgatatgtttgcaattctaaaaaataacttcactaagcatatgacacaatcaaagttgagtaaaatgaaatttatcgatttctattaggatgatcatg 116  Q
    ||||||||||||| |||| | ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
43306274 attgatatgtttgtaattttcaaaaataacgtcactaagcatatgacacaatcaaagttgagtaaaatgaaatttatcgttttctattaggatgatcatg 43306373  T
117 ttatatctctattacctattt 137  Q
    |||||||||||||||||||||    
43306374 ttatatctctattacctattt 43306394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 141 - 240
Target Start/End: Original strand, 43306636 - 43306736
Alignment:
141 gatgttggtgtttgcactggctcgaatatgataaaatagtggaatcattat-nnnnnnnnntgttaacaaaaacaaagtaaatattctaagaatggatag 239  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||||||||||    
43306636 gatgttggtgtttgcactggctcgaatatgataaaatagtggaatcattataaaaaaaaaatgttaacaaaaacaaagtaaatattctaagaatggatag 43306735  T
240 a 240  Q
    |    
43306736 a 43306736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University