View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19376_high_13 (Length: 221)
Name: NF19376_high_13
Description: NF19376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19376_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 47770452 - 47770660
Alignment:
| Q |
1 |
atttggagttgtttatcgggtaagatacccatttcaattattcatgaaaatatcatcttctgcaaaatattatcatagaaaagnnnnnnnnnntt-acta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
47770452 |
atttggagttgtttatcgggtaagatacccatttcaattattcatgaaaatatcatcttctgcaaaatattatcatagaaaaaaaaaatataatttacta |
47770551 |
T |
 |
| Q |
100 |
tacctttatatatttcaggggaagcttcctgatggacaaatgattgctgtaaaaagattgttaaaaggttccagccaaggagatatggaatttaaaaatg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
47770552 |
tacctttatatatttcaggggaagcttcctgatggacaaatgattgctgtaaaaagattgttaaaagattccagccaaggagatgtggaatttaaaaatg |
47770651 |
T |
 |
| Q |
200 |
aagtattat |
208 |
Q |
| |
|
||||||||| |
|
|
| T |
47770652 |
aagtattat |
47770660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 107 - 204
Target Start/End: Original strand, 47774467 - 47774564
Alignment:
| Q |
107 |
atatatttcaggggaagcttcctgatggacaaatgattgctgtaaaaagattgttaaaaggttccagccaaggagatatggaatttaaaaatgaagta |
204 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||||||||| || |||||||||| |||| ||| |||||||||| |||||||||||||||||||| |
|
|
| T |
47774467 |
atatatttcagggcaagctccctaatggacaaatgattgcggtcaaaagattgtccaaagattctgaccaaggagatgtggaatttaaaaatgaagta |
47774564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University