View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19376_low_6 (Length: 322)
Name: NF19376_low_6
Description: NF19376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19376_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 74 - 305
Target Start/End: Original strand, 30193989 - 30194220
Alignment:
| Q |
74 |
gcttatcgtttttgtggacatacttgagacaacagtcccattcgtgatgagagagctctaagatatattttggttgttaactatgcagctaattcttctt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30193989 |
gcttatcgtttttgtggacatacttgagacaacagtcccattcgtgatgagagagctctaagatatattttggttgttaactatgcagctaattcttctt |
30194088 |
T |
|
| Q |
174 |
ctgctagtagttttaataatcacaaacattactcttacaaccagcgtaatgctaggctacaaatgtaacagcttgtgcaatttattttgttggtttttgt |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30194089 |
ctgctagtagttttaataatcacaaacattactcttacaaccagcgtaatgctaggctacaaatgtaacagcttgtgcaatttattttgttggtttttgt |
30194188 |
T |
|
| Q |
274 |
ttgtagaatttggatgattttgtgttagtacc |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30194189 |
ttgtagaatttggatgattttgtgttagtacc |
30194220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 30193884 - 30193956
Alignment:
| Q |
1 |
cttctatccaccaagacttttttgatcgattcatcctactactcacaatgctttggagcaaaacaacaaccac |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30193884 |
cttctatccaccaagacttttttgatcgattcatcctactactcacaatgctttggagcaaaacaacaaccac |
30193956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 100 - 198
Target Start/End: Original strand, 30193526 - 30193624
Alignment:
| Q |
100 |
agacaacagtcccattcgtgatgagagagctctaagatatattttggttgttaactatgcagctaattcttcttctgctagtagttttaataatcacaa |
198 |
Q |
| |
|
||||||||||| ||| |||||| |||| ||||||||||||| ||||| |||| |||||| |||||| ||||| || | | |||||||||||||||| |
|
|
| T |
30193526 |
agacaacagtcttatttgtgatgtgagacctctaagatatatggtggttattaattatgcaactaattattcttatgttcatggttttaataatcacaa |
30193624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University