View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19378_low_5 (Length: 291)
Name: NF19378_low_5
Description: NF19378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19378_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 5 - 113
Target Start/End: Original strand, 42003468 - 42003576
Alignment:
| Q |
5 |
ttgtggaaactgtgaagcaaggggaggacgatgtggattggttggggatgatgctcttcgtcttgcttgttatgatcttcccacccaaggtcagaaattg |
104 |
Q |
| |
|
||||||||| ||||||||| | |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
42003468 |
ttgtggaaattgtgaagcacgtggaggaagatgtggattggttggggatgatgctcttcgtcttgcttgttatgatcttcccacccaaggtgagaaatag |
42003567 |
T |
 |
| Q |
105 |
ttaatgatg |
113 |
Q |
| |
|
| ||||||| |
|
|
| T |
42003568 |
tcaatgatg |
42003576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University