View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19378_low_7 (Length: 212)
Name: NF19378_low_7
Description: NF19378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19378_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 13 - 194
Target Start/End: Original strand, 46153671 - 46153860
Alignment:
| Q |
13 |
aagaatatggttgtaaggaaaggaagnnnnnnnnnctctaaggttcagtttagtggtaaaccgatagggttttgaactgaagct--------taaaaaga |
104 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46153671 |
aagaaaatggttgtaaggaaaggaagaaaaaaaaactctaaggttcagtttagtggtaaaccgatagggttttgaactgaagctagtgttattaaaaaga |
46153770 |
T |
 |
| Q |
105 |
tgtaaatgtaaactttttctgcaaatgttttcgagtcttaagatttaatttgctttagatttagacatcatcgtgtcacatgaaattttt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46153771 |
tgtaaatgtaaactttttctgcaaatgttttcgagtcttaagatttaatttgctttagatttagacatcatcgtgtcacatgaaattttt |
46153860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University