View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19379_high_50 (Length: 327)
Name: NF19379_high_50
Description: NF19379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19379_high_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 12 - 311
Target Start/End: Complemental strand, 39076841 - 39076542
Alignment:
| Q |
12 |
atgaatagaaccgggtttatggttaattcgcctgcgtttcttggccaaggttcgactttttccgcccatagggggacccttcagtccagtttttcgccat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076841 |
atgaatagaaccgggtttatggttaattcgcctgcgtttcttggccaaggttcgactttttccgcccatagggggacccttcagtccagtttttcgccat |
39076742 |
T |
|
| Q |
112 |
cacttcgtccttggaatgatattccaattgcggatgcctcggtggatcatcatagtcacaagtctcaacaacaaattcaccaagcttctatcttcggtag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076741 |
cacttcgtccttggaatgatattccaattgcggatgcctcggtggatcatcataatcacaagtctcaacaacaaattcaccaagcttctatcttcggtag |
39076642 |
T |
|
| Q |
212 |
caggtttctgtctgatgctttgacaggtttctgtattcctgctagaattcaaggtgaggatgagagccatggagttggttccgaaaggccatcctcttct |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076641 |
caggtttctgtctgatgctttgacaggtttctgtattcctgctagaattcaaggtgaggatgagagccatggagttggttccgaaaggccatcctcttct |
39076542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University