View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19379_high_51 (Length: 325)
Name: NF19379_high_51
Description: NF19379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19379_high_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 104 - 310
Target Start/End: Complemental strand, 37535813 - 37535608
Alignment:
| Q |
104 |
cttaaagctcatgctaactcatgtcgttaagacacatgataaagtttccacgactaatacgtatttatcgtnnnnnnnntgtaattatagaaagtttaag |
203 |
Q |
| |
|
||||||| |||||||||||| |||| |||||||||||||||| | ||| |||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37535813 |
cttaaagttcatgctaactcgtgtctttaagacacatgataaggcttctacgagtagtacgtatttatcgtaaaaaaa-tgtaattatagaaagtttaag |
37535715 |
T |
 |
| Q |
204 |
aaataaatttccacaatttcaattaatataataatgtggttttgacaacaaccatcttgtgttgctgttggttggcagtgatttagacttgaaagcgccc |
303 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37535714 |
aaataaatttgcacaatttcaattaatataataatgtggttttgacaacaaccatcttgtgttgctgttggttggcagtgatttagacttgaaagcgccc |
37535615 |
T |
 |
| Q |
304 |
atctttt |
310 |
Q |
| |
|
||||||| |
|
|
| T |
37535614 |
atctttt |
37535608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University