View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19379_high_65 (Length: 298)
Name: NF19379_high_65
Description: NF19379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19379_high_65 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 46983028 - 46983315
Alignment:
| Q |
1 |
ttaaacttttatgaaatattaatgacatctttttaatgactatttcaccaagattaatttcaaccnnnnnnnnnnnnnncggtagacacattaatttcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46983028 |
ttaaacttttatgaaatattaatgacatctttttaatgactataccaccaagattaatttcaacctttttttcttttttcggtagacacattaatttcaa |
46983127 |
T |
 |
| Q |
101 |
tttcactgaaatataaagttgttgtttgtgacattacatgaacatgcattgtttaatttattggtgcattgtgtttttaggagcgggaaagagccttgag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46983128 |
tttcactgaaatataaagttgttgtttgtgacattacatgaacatacattgtttaatttattggtgcactgtgtttttaggagcgggaaagagccttgag |
46983227 |
T |
 |
| Q |
201 |
atcatttaaacgtggtcttactccgataatggttgcaactgatgttgcttctcgaggattggatatccctcacgtggctcatgttatt |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46983228 |
atcatttaaacgtggtcttactccgataatggttgcaactgatgttgcttctcgaggattggatatccctcacgtggctcatgttatt |
46983315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 113 - 153
Target Start/End: Original strand, 46982967 - 46983007
Alignment:
| Q |
113 |
ataaagttgttgtttgtgacattacatgaacatgcattgtt |
153 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| ||||||| |
|
|
| T |
46982967 |
ataaagttgtcgtttgtgatattacatgaacatacattgtt |
46983007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University