View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19379_high_73 (Length: 265)
Name: NF19379_high_73
Description: NF19379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19379_high_73 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 11611909 - 11612061
Alignment:
| Q |
1 |
caaactaaacaaggaccctcatccctagatnnnnnnnnn-ttatgcaatcttgataatgacttatgcaactgacacacacacatattaagaaagagnnnn |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11611909 |
caaactaaacaaggaccctcatccctagataaaaaaaaaattatgcaatcttgataatgacttatgcaactgacacacacacatattaagaaagagaaaa |
11612008 |
T |
 |
| Q |
100 |
nnncagacactcacaacaaacatagcatagcaaaacactattcaacattcatg |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612009 |
aaacagacactcacaacaaacatagcatagcaaaacactattcaacattcatg |
11612061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University