View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19379_high_83 (Length: 237)
Name: NF19379_high_83
Description: NF19379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19379_high_83 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 15 - 224
Target Start/End: Complemental strand, 7948137 - 7947928
Alignment:
| Q |
15 |
accaatgacaaccgatgttgctcttggaagtagaaaatcgcagtcatcgttgctgtcataggtgatatggtgacttgattggtgcgtgttctaccaaaac |
114 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7948137 |
accaatgacaaccgatgttgatcttggaagtagaaaatcacagtcatcgttgctgtcataggtgatatggtgacttgattggtgcgtgttctaccaaaac |
7948038 |
T |
 |
| Q |
115 |
atagaaaaacgaatatgagttgagttttgttgactcattcgttttcccatatgnnnnnnncgaactagtaccaatcaagtcaccatctcactcatgaaga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
7948037 |
atagaaaaacgaatatgagttgagttttgttggctcattcgttttcccatatgtttttttcgaactagtatcaatcaagtcaccgtctcactcatgaaga |
7947938 |
T |
 |
| Q |
215 |
caaagaggat |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
7947937 |
caaagaggat |
7947928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University