View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19379_high_93 (Length: 208)
Name: NF19379_high_93
Description: NF19379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19379_high_93 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 34349531 - 34349360
Alignment:
| Q |
19 |
atctctcaggagacgggtatccagttgatgattgacttgtttggtgttgtcgagcatactgcgattgatgagagagctaactagtttggtgctttttcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34349531 |
atctctcaggagacgggtatccagttgacgattgacttgtttggtgttgtcgagcatactgcgattgatgagagagctaactagtttggtgctttttcaa |
34349432 |
T |
|
| Q |
119 |
atattcccttcctaaagagaatacgtgaggagcacctcaatatggcaacttagtgggagaatgagggaaata |
190 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34349431 |
atattcccttcctaaagagaatacgcgaggagcacctcaatatggcaacttagtgggagaatgagggaaata |
34349360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 59 - 181
Target Start/End: Original strand, 16782302 - 16782424
Alignment:
| Q |
59 |
ttggtgttgtcgagcatactgcgattgatgagagagctaactagtttggtgctttttcaaatattcccttcctaaagagaatacgtgaggagcacctcaa |
158 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| | | | || ||||||| | |||| ||||||||| |||||||| ||||| ||| ||||||||||| |
|
|
| T |
16782302 |
ttggtgttgtcgagcatcgtgcaattgatgagtgtgatcaccagtttggggattttataaatattccactcctaaagggaatatatgacgagcacctcaa |
16782401 |
T |
|
| Q |
159 |
tatggcaacttagtgggagaatg |
181 |
Q |
| |
|
||||| |||| ||| |||||||| |
|
|
| T |
16782402 |
tatggaaactcagttggagaatg |
16782424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University