View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19379_high_93 (Length: 208)

Name: NF19379_high_93
Description: NF19379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19379_high_93
NF19379_high_93
[»] chr1 (1 HSPs)
chr1 (19-190)||(34349360-34349531)
[»] chr7 (1 HSPs)
chr7 (59-181)||(16782302-16782424)


Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 34349531 - 34349360
Alignment:
19 atctctcaggagacgggtatccagttgatgattgacttgtttggtgttgtcgagcatactgcgattgatgagagagctaactagtttggtgctttttcaa 118  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34349531 atctctcaggagacgggtatccagttgacgattgacttgtttggtgttgtcgagcatactgcgattgatgagagagctaactagtttggtgctttttcaa 34349432  T
119 atattcccttcctaaagagaatacgtgaggagcacctcaatatggcaacttagtgggagaatgagggaaata 190  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
34349431 atattcccttcctaaagagaatacgcgaggagcacctcaatatggcaacttagtgggagaatgagggaaata 34349360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 59 - 181
Target Start/End: Original strand, 16782302 - 16782424
Alignment:
59 ttggtgttgtcgagcatactgcgattgatgagagagctaactagtttggtgctttttcaaatattcccttcctaaagagaatacgtgaggagcacctcaa 158  Q
    |||||||||||||||||  ||| ||||||||| | | | || ||||||| | ||||  |||||||||  |||||||| |||||  ||| |||||||||||    
16782302 ttggtgttgtcgagcatcgtgcaattgatgagtgtgatcaccagtttggggattttataaatattccactcctaaagggaatatatgacgagcacctcaa 16782401  T
159 tatggcaacttagtgggagaatg 181  Q
    ||||| |||| ||| ||||||||    
16782402 tatggaaactcagttggagaatg 16782424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University