View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19379_low_30 (Length: 406)
Name: NF19379_low_30
Description: NF19379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19379_low_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 13 - 387
Target Start/End: Original strand, 40434629 - 40435003
Alignment:
| Q |
13 |
aaaatcttttccagcctcggcaaatatcacgttgttggtctctttgtcgataagaagtttcaactccactgttgcttcagttgtaacagcaacaacaccc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40434629 |
aaaatcttttccagcctcggcaaatatcacgttgttggtctctttgtcgataagaagtttcaactccactgttgcttcagttgtaacagcaacaccaccc |
40434728 |
T |
|
| Q |
113 |
cgctttggtgtaacaacatcattgttattgttctcaccacttgcttcagctgtaatatgacccatgatagaagcagctatatatagaaacaaaaatttac |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40434729 |
cgctttggtgtaacaacatcattgttattgttctcaccacttgcttcagctgtaatatgacccatgatagaagcagctatatatagaaacacaaatttac |
40434828 |
T |
|
| Q |
213 |
tatcaaaactcagaaaaatggtaataatgtaacattagcattcggttggcatacgacatttattaggtctattttaggataccttgacccataacagtaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40434829 |
tatcaaaactcagaaaaatggtaataatgtaacattagcattcggttggcatacgacatttattaggtctattttaggataccttgacccataacagtaa |
40434928 |
T |
|
| Q |
313 |
cagcggcggtggattggtccgtgacaaagcggcgagacggtgataacgggtgctggttggcggtgatggggcgac |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40434929 |
cagcggcggtggattggtccgtgacaaagcggccagacggtgataacgggtgctggttggcggtgatggggcgac |
40435003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University