View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19379_low_33 (Length: 397)
Name: NF19379_low_33
Description: NF19379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19379_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 16 - 378
Target Start/End: Complemental strand, 22528248 - 22527888
Alignment:
| Q |
16 |
atatacaaagaggatgatatcttaataattttaaaggctttgtcaaatttttacacgagacgattctcttgattctcctagggtatcaaaattcaaagaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22528248 |
atatacaaagaggatgatatcttaataattttaaaggctttgtcaaatttttacacgagacgattctcttgattctcctagggtatcaaaattcaaagaa |
22528149 |
T |
 |
| Q |
116 |
ttgaacctgattgccatcaaaggctgcaacatgttgcaagaaattaataatttgtcagcatcttactcttcaatctgaatatcaatacgaattatctaca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22528148 |
ttgaacctgattgccatcaaaggctgcaacattttgcaagaaattaataatttgtcagcatcttactctacaatctgaatatcaatacgaattatctaca |
22528049 |
T |
 |
| Q |
216 |
aacagaacaaagatatatccgtcggaatcttgttcaacaatgtagacatagaatgattcatgcaacttcttcaactttagacatgacagagaatctgcta |
315 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22528048 |
aacagaacaaagatatatctgtcggaa--ttgttcaacaatgtagacatagaatgattcatgcaacttcttcaactttagacatgacagagaatctgcta |
22527951 |
T |
 |
| Q |
316 |
ggtcttggctggaaattgcaacgtctgcgctggttatacgaacacctccgaatcagcgcttcc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22527950 |
ggtcttggctggaaattgcaacgtctgcgctggttatacgaacacctccgaatcagcgcttcc |
22527888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University