View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19379_low_37 (Length: 389)
Name: NF19379_low_37
Description: NF19379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19379_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 47 - 370
Target Start/End: Complemental strand, 51845300 - 51844977
Alignment:
| Q |
47 |
tatcttgtccggatccatcgctaggtggtgacgttaaatccgaagaaggatcgcatgctttgtcaagtggcttcccacaaagctcttcatttcctgcaaa |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51845300 |
tatcttgtccggatccatcgctaggtggtgacgttaaatccgaagaaggatcgcatgctttgtcaagtggcttcccacaaagctcttcatttcctgcaaa |
51845201 |
T |
 |
| Q |
147 |
agattttgcctcatacttggacaagggaccaggtattgcaccttgtaacttgttgttagacacgtctaaagatttaatatcttgtttgaattctggaata |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51845200 |
agattttgcctcatacttggacaagggaccaggtattgcaccttgtaacttgttgttagacatgtctaaagatttaatatcttgtttgaattctggaata |
51845101 |
T |
 |
| Q |
247 |
ggaccagagaactcattgttatcgagatgtaactcaccgaggaaacgaagatttgttaatgagtctggtatatttcctgagaatttattattgttgagcc |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51845100 |
ggaccagagaactcattgttatcgagatgtaactcaccgaggaaacgaagatttgttaatgagtctggtatatttcctgagaatttattattgttgagcc |
51845001 |
T |
 |
| Q |
347 |
atactttcttgagagaacctaaat |
370 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
51845000 |
atactttcttgagagaacctaaat |
51844977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University