View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19379_low_67 (Length: 297)
Name: NF19379_low_67
Description: NF19379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19379_low_67 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 19 - 154
Target Start/End: Original strand, 26882783 - 26882918
Alignment:
| Q |
19 |
gatgactataaatgtgacaaaatcaaagtgatttgaatatccacgtcttcactttaacgttgatgcctaagtcattatttaaatctgtaatacatcaaag |
118 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26882783 |
gatgcctataaatgtgacaaaatcaaagtgatttgaatatccaagtcttcactttaacgttgatgcctaagtcattatttaaatctgtaatacatcaaag |
26882882 |
T |
|
| Q |
119 |
ttgatctggtagtttgaatcaaacgaatatcacaag |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
26882883 |
ttgatctggtagtttgaatcaaacgaatatcacaag |
26882918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 207 - 287
Target Start/End: Original strand, 26882974 - 26883055
Alignment:
| Q |
207 |
tcacttctatgtaaaaatccacttatttagatcaaatag-nnnnnnnntgacggagaagatgattccaaaaccactatattc |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
26882974 |
tcacttctatgtaaaaatccacttatttagatcaaatagaaaaaaaaatgatggagaagatgattccaaaaccactatattc |
26883055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University