View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19379_low_78 (Length: 252)
Name: NF19379_low_78
Description: NF19379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19379_low_78 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 14 - 127
Target Start/End: Original strand, 29336484 - 29336597
Alignment:
| Q |
14 |
atgaatctctagtataaatgnnnnnnnntatcttaaattattgaattccaagaactaaataacttgtgagactgatggtagataaagtgaattagctaac |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
29336484 |
atgaatctctagtataaatgaaaaaaaatatcttaaattattgaattccaagaactaaataacttgtgagattgatggtagataaagtgagttagctaac |
29336583 |
T |
 |
| Q |
114 |
aaccatgacagtac |
127 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
29336584 |
aaccatgacagtac |
29336597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 160 - 252
Target Start/End: Original strand, 29336630 - 29336722
Alignment:
| Q |
160 |
taatagtatcttcatagccaaatgatttgacttaagtagttaataattttcaataacagtctaatcaatccggagtaaccgaattcaaaccat |
252 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
29336630 |
taatagtatcttcatagccaagtgatttgacttaagtagttaataattttcaataacggtctaatcaacccggagtagccgaattcaaaccat |
29336722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University