View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19379_low_78 (Length: 252)

Name: NF19379_low_78
Description: NF19379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19379_low_78
NF19379_low_78
[»] chr3 (2 HSPs)
chr3 (14-127)||(29336484-29336597)
chr3 (160-252)||(29336630-29336722)


Alignment Details
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 14 - 127
Target Start/End: Original strand, 29336484 - 29336597
Alignment:
14 atgaatctctagtataaatgnnnnnnnntatcttaaattattgaattccaagaactaaataacttgtgagactgatggtagataaagtgaattagctaac 113  Q
    ||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||    
29336484 atgaatctctagtataaatgaaaaaaaatatcttaaattattgaattccaagaactaaataacttgtgagattgatggtagataaagtgagttagctaac 29336583  T
114 aaccatgacagtac 127  Q
    ||||||||||||||    
29336584 aaccatgacagtac 29336597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 160 - 252
Target Start/End: Original strand, 29336630 - 29336722
Alignment:
160 taatagtatcttcatagccaaatgatttgacttaagtagttaataattttcaataacagtctaatcaatccggagtaaccgaattcaaaccat 252  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |||||||||||||||    
29336630 taatagtatcttcatagccaagtgatttgacttaagtagttaataattttcaataacggtctaatcaacccggagtagccgaattcaaaccat 29336722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University