View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19379_low_82 (Length: 242)
Name: NF19379_low_82
Description: NF19379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19379_low_82 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 3654756 - 3654538
Alignment:
| Q |
18 |
aatatagggttgggttgtgagataaataaattaaatatgctaataattatttcaatcacggttggaactcaagtcttttcaaacaaattcttatgtgtat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3654756 |
aatatagggttgggttgtgagataaataaattaaatatgctaataattatttcaatcactgtttgaactcaagtcttttcaaacaaattcttatgtgtat |
3654657 |
T |
 |
| Q |
118 |
atgttacctaaatataaaatacaataaattaaaaatggattgaaatccatgtctatcttcatacacgaggtacttctatgttcgaaatagacaaaacaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3654656 |
atgttacctaaatataaaatacaataaattaaaaattgattgaaatccatgtctatcttcatacacgaggtacttctatgttcgaaatagacaaaacaac |
3654557 |
T |
 |
| Q |
218 |
aaggacgtaacctttgctt |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
3654556 |
aaggacgtaacctttgctt |
3654538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University