View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19379_low_86 (Length: 237)
Name: NF19379_low_86
Description: NF19379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19379_low_86 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 39111647 - 39111867
Alignment:
| Q |
1 |
cttcaacttgaggaatggaagttggagaatgaagactgagaaatttgaggcagtaaacaaggaagacacttgcaacatttctaatcatttactgggaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39111647 |
cttcaacttgaggaatggaagttggacaatgaagactgagaaatttgaggcagtaaacaaggaagacacttgcaacatttctaatcatttactgggaaaa |
39111746 |
T |
|
| Q |
101 |
aatctagaggaaataaacactgatgttgatgtggctgtgagaaggaaccaaacttatttagatgtggccaaatatattgctagtagcctccctaagtttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39111747 |
aatctagaggaaataaacactgatgttgatgtggctgtgagaaggaaccaaacttatttagatgtggccaaatatattgctagtagcctccctaagtttc |
39111846 |
T |
|
| Q |
201 |
cacctcagggaatattgcagg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39111847 |
cacctcagggaatattgcagg |
39111867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University