View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19379_low_88 (Length: 234)

Name: NF19379_low_88
Description: NF19379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19379_low_88
NF19379_low_88
[»] chr6 (2 HSPs)
chr6 (30-137)||(13476130-13476237)
chr6 (181-218)||(14108390-14108427)
[»] chr3 (1 HSPs)
chr3 (174-218)||(24786788-24786832)


Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 30 - 137
Target Start/End: Complemental strand, 13476237 - 13476130
Alignment:
30 attacaaacaaagtgcgaaaaatgtaaagttgcaaactctcttcctcaggtataatctaccacttgattttttgctgacagagataagaaaattttattt 129  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || ||||||||||||| ||||    
13476237 attactaacaaagtgcgaaaaatgtaaagttgcaaactctcttcctcaggtataatctaccacttgagtttttgctgagagggataagaaaatttaattt 13476138  T
130 tctttctt 137  Q
    ||||||||    
13476137 tctttctt 13476130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 14108390 - 14108427
Alignment:
181 ctttatcgattctcatgttgatgtggtagattctaccc 218  Q
    ||||||||||||||||||||||||||||||||||||||    
14108390 ctttatcgattctcatgttgatgtggtagattctaccc 14108427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 218
Target Start/End: Original strand, 24786788 - 24786832
Alignment:
174 ttgctgtctttatcgattctcatgttgatgtggtagattctaccc 218  Q
    ||||||||||||||| ||||| |||||||||||||| ||||||||    
24786788 ttgctgtctttatcggttctcctgttgatgtggtaggttctaccc 24786832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University