View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19379_low_88 (Length: 234)
Name: NF19379_low_88
Description: NF19379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19379_low_88 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 30 - 137
Target Start/End: Complemental strand, 13476237 - 13476130
Alignment:
| Q |
30 |
attacaaacaaagtgcgaaaaatgtaaagttgcaaactctcttcctcaggtataatctaccacttgattttttgctgacagagataagaaaattttattt |
129 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || ||||||||||||| |||| |
|
|
| T |
13476237 |
attactaacaaagtgcgaaaaatgtaaagttgcaaactctcttcctcaggtataatctaccacttgagtttttgctgagagggataagaaaatttaattt |
13476138 |
T |
|
| Q |
130 |
tctttctt |
137 |
Q |
| |
|
|||||||| |
|
|
| T |
13476137 |
tctttctt |
13476130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 181 - 218
Target Start/End: Original strand, 14108390 - 14108427
Alignment:
| Q |
181 |
ctttatcgattctcatgttgatgtggtagattctaccc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14108390 |
ctttatcgattctcatgttgatgtggtagattctaccc |
14108427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 174 - 218
Target Start/End: Original strand, 24786788 - 24786832
Alignment:
| Q |
174 |
ttgctgtctttatcgattctcatgttgatgtggtagattctaccc |
218 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
24786788 |
ttgctgtctttatcggttctcctgttgatgtggtaggttctaccc |
24786832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University