View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19379_low_95 (Length: 212)
Name: NF19379_low_95
Description: NF19379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19379_low_95 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 63 - 192
Target Start/End: Complemental strand, 51361735 - 51361606
Alignment:
| Q |
63 |
aaacattgttcaaaaaatattctgcatgaccattattttagctatctatacaaacaccttggttggttgtgttttcttagaattttgatttcttttaact |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51361735 |
aaacattgttcaaaaaatattctgcatgaccattattttagctatctatacaaacaccttggttggttgtgttttctttgaattttgatttcttttaact |
51361636 |
T |
 |
| Q |
163 |
cgattctttcaaaatttgcgtgcaaagaga |
192 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |
|
|
| T |
51361635 |
cgattcttacaaaatttgcgtgcaaagaga |
51361606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 21 - 65
Target Start/End: Complemental strand, 51361828 - 51361784
Alignment:
| Q |
21 |
agagtgttcatgttaacatgtttaatgtgttttcccctacttaaa |
65 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51361828 |
agagtgttcatgttaacatgtttaatatgttttcccctacttaaa |
51361784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University