View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19380_high_35 (Length: 416)
Name: NF19380_high_35
Description: NF19380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19380_high_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 47654523 - 47654280
Alignment:
| Q |
1 |
tggtttagtgcaatgcaagctacccgaagcaaatgcggcatgttttgaaggacaacaaacttcaagcgatgtggtgaacagaccagtgttctgattgtat |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47654523 |
tggtttagtgcaatgcaagctacctgaagcaaatgcggcatgttttgaaggacaacaaacttcaagcgatgtggtgaacagaccagtgttctgattgtat |
47654424 |
T |
|
| Q |
101 |
gtttgaaagattcaagaagcattaattagagcagataaaatgtcattttgttgaagtttttggcgcatataaagtttttcatattgatttgcgttgaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47654423 |
gtttgaaagattcaagaagcattaattagagcagataaaatgtcattttgttgaagtttttggcgcatataaagtttttcatattgatttgcgttgaaca |
47654324 |
T |
|
| Q |
201 |
tggttcataggtacgcacaagtgggtagggatggttcgtacacg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47654323 |
tggttcataggtacgcacaagtgggtagggatggttcgtacacg |
47654280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 309 - 416
Target Start/End: Complemental strand, 47654285 - 47654178
Alignment:
| Q |
309 |
tacacaattatacgggcacaattgaccgaattttattaccaaacttcgtttatctattgtttacggttgccgtttaattttcctttcataattggttgtt |
408 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47654285 |
tacacgattatacgggcacaattgaccgaattttattaccaaactttgtttatctattgtttacggttgccgtttaatttccctttcataattggttgtt |
47654186 |
T |
|
| Q |
409 |
gttctaac |
416 |
Q |
| |
|
|||||||| |
|
|
| T |
47654185 |
gttctaac |
47654178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University