View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19380_high_57 (Length: 319)
Name: NF19380_high_57
Description: NF19380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19380_high_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 60 - 276
Target Start/End: Complemental strand, 46343202 - 46342986
Alignment:
| Q |
60 |
ctgtgtctctctctttttacttgttttgttcttgttaattcaactcagacccaaatctataatctaaataaaggtttcatttttaagattgttttgttaa |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46343202 |
ctgtgtctctctctttttacttgttttgttcttgttaattcaactcagacccaaatctataatctaaataaaggtttcatttttaagattgttttgttaa |
46343103 |
T |
 |
| Q |
160 |
attgaactaaaagggttattggattttctgttattttggaatggcaccaagttttgattgtgtttctagccttctttgcactgaggaagatagcagtgtt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46343102 |
attgaactaaaagggttattggattttctgttattttggaatggcaccaagttttgattgtgtttctagccttctttgcactgaggaagatagcagtgtt |
46343003 |
T |
 |
| Q |
260 |
tttgatgatgctgaata |
276 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
46343002 |
tttgatgatgctgaata |
46342986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 188 - 276
Target Start/End: Original strand, 31294704 - 31294792
Alignment:
| Q |
188 |
tgttattttggaatggcaccaagttttgattgtgtttctagccttctttgcactgaggaagatagcagtgtttttgatgatgctgaata |
276 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| | |||||||||||||| || ||||||||||||||||| ||||||| |||||| |
|
|
| T |
31294704 |
tgttattttgaaatggaaccaagttttgattgtgttgcaagccttctttgcaccgaagaagatagcagtgttttcgatgatgttgaata |
31294792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University