View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19380_high_71 (Length: 237)
Name: NF19380_high_71
Description: NF19380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19380_high_71 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 42226619 - 42226840
Alignment:
| Q |
1 |
ctactctctttttggtttaacacaagcatgtgattaaagaatgatatacattgataaagtaaacaaatttcacacatgcatccaattaaaatatgttaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42226619 |
ctactctctttttggtttaacacaagcatgtgattaaagaatgatatacattgataatgtaaacaaatttcacacatgcatccaattaaaatatgttaaa |
42226718 |
T |
 |
| Q |
101 |
taggtatttat-nnnnnnnnttatgaattaatccaaaaaagacatcatagaatgatttgatttgatgtatgtgtaaaaatttgcaagtatatacaagtca |
199 |
Q |
| |
|
| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42226719 |
ttggtatttataaaaaaaaaatatgaattaatccaaaaaagacatcatagaatgatttgatttgatgtatgtgtaaaaatttgcaagtatatacaagtca |
42226818 |
T |
 |
| Q |
200 |
aatccatctactacgaatactg |
221 |
Q |
| |
|
||||| ||||||| |||||||| |
|
|
| T |
42226819 |
aatccgtctactatgaatactg |
42226840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University