View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19380_high_72 (Length: 235)
Name: NF19380_high_72
Description: NF19380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19380_high_72 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 35275120 - 35275337
Alignment:
| Q |
1 |
aaatctttaaatttaatctcttctagatgttatggactaaatagagaaaatttatatattttatggattaaattaacgcatttcatatactttacacaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35275120 |
aaatctttaaatttaatctcttctagatgttatggactaaatagagaaattttatatattttatggattaaattaacgcatttcatatgctttacacaac |
35275219 |
T |
 |
| Q |
101 |
ttattatgtttatataacttatggaccggatcgaaatgatgtgataacttaggtactaaattgatagatttttctttatttaaactctttcaaatcttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35275220 |
ttattatgtttatataacttatggaccggatcgaaatgatgtgataacttaggtactaaattgatagatttttctttatttaaactctttcaaatcttga |
35275319 |
T |
 |
| Q |
201 |
tggatttcatatagttaa |
218 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
35275320 |
tggatttcctatagttaa |
35275337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University