View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19380_high_76 (Length: 229)
Name: NF19380_high_76
Description: NF19380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19380_high_76 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 54 - 176
Target Start/End: Complemental strand, 35274995 - 35274873
Alignment:
| Q |
54 |
aaagagataaattggtctatttcctaaataggaaatttgtgaatgaagttaatgattctataacacaaacccgtggcactagtttgagaccaaagaaaca |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35274995 |
aaagagataaattggtctatttcctaaataggaaatttgtgaatgaagttaatgattctataacacaaacccgtggcactagtttgagaccaaagaaaca |
35274896 |
T |
 |
| Q |
154 |
ttacaacttcactacttttgatg |
176 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
35274895 |
ttacaacttcactacttttgatg |
35274873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 35275051 - 35275020
Alignment:
| Q |
1 |
actgaatgataattataaagagatgttataaa |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35275051 |
actgaatgataattataaagagatgttataaa |
35275020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University