View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19380_low_24 (Length: 466)
Name: NF19380_low_24
Description: NF19380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19380_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 46342995 - 46342737
Alignment:
| Q |
1 |
atgctgaatatggtggtggtggttcggtggaggtgtacggggattcgtggcgccctaggaatgatcatcagatgactcaacaacgttatgatggtgttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46342995 |
atgctgaatatggtggtggtggttcggtggaggtgtacggggattcgtggcgtcctaggaatgatcatcagatgactcaacaacgttatgatggtgttcc |
46342896 |
T |
|
| Q |
101 |
tgatgagttgccattgcagagtgaagagtgtttggttctgatgttggaaaaagagtgtcagcaatggcctggtgctgattatttgaataagttgcggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46342895 |
tgatgagttgccattgcagagtgaagagtgtttggttctgatgttggaaaaagagtgtcagcaatggcctggtgctgattatctgaataagttgcggttt |
46342796 |
T |
|
| Q |
201 |
ggagatttggattttgaggctagaaatgaagtcatcgattggattcaaaaggtagattc |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46342795 |
ggagatttggattttgaggctagaaatgaagtcatcgattggattcaaaaggtagattc |
46342737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 321 - 456
Target Start/End: Complemental strand, 46342675 - 46342540
Alignment:
| Q |
321 |
tgggtctgaaatgagatatgaacgatgatttaattttacatcaaaacagtggcggcggcgttttaattggatttggattggatttaatgaactatctctt |
420 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46342675 |
tgggtctgaaatgagatatgaacgatgatttaatttttcatcaaaacagtggcggcggcgttttaattggatttggattggatttaataaactatctctt |
46342576 |
T |
|
| Q |
421 |
tatggatacatatcacaatctgtttgtttgatgatg |
456 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
46342575 |
tatggatacatatcacaatctgtttgtttgatgatg |
46342540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 94; Significance: 1e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 108 - 253
Target Start/End: Original strand, 31294875 - 31295020
Alignment:
| Q |
108 |
ttgccattgcagagtgaagagtgtttggttctgatgttggaaaaagagtgtcagcaatggcctggtgctgattatttgaataagttgcggtttggagatt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
31294875 |
ttgccattgcagagtgaagagtgtttggttctgatgttggaaaaagaatgtcaacaatggcatggtgctgattacttgaataggttaaagtttggagatt |
31294974 |
T |
|
| Q |
208 |
tggattttgaggctagaaatgaagtcatcgattggattcaaaaggt |
253 |
Q |
| |
|
||||||||| || |||||||||| ||| ||||||||||||||||| |
|
|
| T |
31294975 |
tggattttggtgcaagaaatgaagccattgattggattcaaaaggt |
31295020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University